FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635550_at:

>probe:Drosophila_2:1635550_at:146:33; Interrogation_Position=230; Antisense; ATCAACCCTCAGGACGACTGTAGTA
>probe:Drosophila_2:1635550_at:683:97; Interrogation_Position=276; Antisense; AGATCGATCGGGACCAGGAGCTCCA
>probe:Drosophila_2:1635550_at:354:75; Interrogation_Position=291; Antisense; AGGAGCTCCAGACATCATCCGAAAT
>probe:Drosophila_2:1635550_at:358:135; Interrogation_Position=362; Antisense; ACGCCCATTCGAGTACGTGACATGA
>probe:Drosophila_2:1635550_at:66:451; Interrogation_Position=385; Antisense; GATCAACCTTTACAACTTTGCCACT
>probe:Drosophila_2:1635550_at:64:143; Interrogation_Position=424; Antisense; ACTGGAGATGGCCAAGTCCCTTTAC
>probe:Drosophila_2:1635550_at:607:147; Interrogation_Position=447; Antisense; ACTTTGGCGCCATGTCAGAGGAAAA
>probe:Drosophila_2:1635550_at:348:91; Interrogation_Position=497; Antisense; AGTAGCCTTTGCAACATGTCCATGT
>probe:Drosophila_2:1635550_at:467:57; Interrogation_Position=543; Antisense; ATGAGAGTATCCTCCGAGTGAACAA
>probe:Drosophila_2:1635550_at:285:225; Interrogation_Position=566; Antisense; AAGGAGTCTGCAGTCTTCCAATCGG
>probe:Drosophila_2:1635550_at:613:715; Interrogation_Position=581; Antisense; TTCCAATCGGCCAATACTGAGCTTC
>probe:Drosophila_2:1635550_at:473:605; Interrogation_Position=598; Antisense; TGAGCTTCCGTCTGATCCGAATACA
>probe:Drosophila_2:1635550_at:222:97; Interrogation_Position=678; Antisense; AGATAGACATAGTGGGCAGCCGCGT
>probe:Drosophila_2:1635550_at:353:47; Interrogation_Position=728; Antisense; ATCCTGTCCGATTTCCAGCAGCATT

Paste this into a BLAST search page for me
ATCAACCCTCAGGACGACTGTAGTAAGATCGATCGGGACCAGGAGCTCCAAGGAGCTCCAGACATCATCCGAAATACGCCCATTCGAGTACGTGACATGAGATCAACCTTTACAACTTTGCCACTACTGGAGATGGCCAAGTCCCTTTACACTTTGGCGCCATGTCAGAGGAAAAAGTAGCCTTTGCAACATGTCCATGTATGAGAGTATCCTCCGAGTGAACAAAAGGAGTCTGCAGTCTTCCAATCGGTTCCAATCGGCCAATACTGAGCTTCTGAGCTTCCGTCTGATCCGAATACAAGATAGACATAGTGGGCAGCCGCGTATCCTGTCCGATTTCCAGCAGCATT

Full Affymetrix probeset data:

Annotations for 1635550_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720