FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635551_at:

>probe:Drosophila_2:1635551_at:193:441; Interrogation_Position=100; Antisense; GATGGTGGACGACAGCACTCGAAAA
>probe:Drosophila_2:1635551_at:324:725; Interrogation_Position=128; Antisense; TTGAGCAACATTCCGCTGCTGCAGA
>probe:Drosophila_2:1635551_at:410:567; Interrogation_Position=248; Antisense; GGCAGCGACTGGTTCCGTCTGGAAT
>probe:Drosophila_2:1635551_at:353:513; Interrogation_Position=304; Antisense; GTGTTGGTACATGCACAACCTGTTA
>probe:Drosophila_2:1635551_at:272:429; Interrogation_Position=347; Antisense; GAGTTCGACATTCCAGTGACGTACC
>probe:Drosophila_2:1635551_at:608:95; Interrogation_Position=387; Antisense; AGATTGCCCTGCCAGAACTTGACGG
>probe:Drosophila_2:1635551_at:646:671; Interrogation_Position=428; Antisense; TACCGTGGTGGCAAGATCTGTCTGA
>probe:Drosophila_2:1635551_at:705:499; Interrogation_Position=447; Antisense; GTCTGACGGATCACTTTAAGCCACT
>probe:Drosophila_2:1635551_at:180:711; Interrogation_Position=462; Antisense; TTAAGCCACTGTGGGCACGCAATGT
>probe:Drosophila_2:1635551_at:509:567; Interrogation_Position=475; Antisense; GGCACGCAATGTTCCCAAGTTTGGG
>probe:Drosophila_2:1635551_at:113:253; Interrogation_Position=490; Antisense; CAAGTTTGGGATCGCCCACGCTATG
>probe:Drosophila_2:1635551_at:54:521; Interrogation_Position=542; Antisense; GTGGAGATTCCGGATCTCATCGAGA
>probe:Drosophila_2:1635551_at:175:633; Interrogation_Position=63; Antisense; TCCGCATTTTCCTTACTTTTGGCTA
>probe:Drosophila_2:1635551_at:606:275; Interrogation_Position=78; Antisense; CTTTTGGCTATTTTCCGGACGAGAT

Paste this into a BLAST search page for me
GATGGTGGACGACAGCACTCGAAAATTGAGCAACATTCCGCTGCTGCAGAGGCAGCGACTGGTTCCGTCTGGAATGTGTTGGTACATGCACAACCTGTTAGAGTTCGACATTCCAGTGACGTACCAGATTGCCCTGCCAGAACTTGACGGTACCGTGGTGGCAAGATCTGTCTGAGTCTGACGGATCACTTTAAGCCACTTTAAGCCACTGTGGGCACGCAATGTGGCACGCAATGTTCCCAAGTTTGGGCAAGTTTGGGATCGCCCACGCTATGGTGGAGATTCCGGATCTCATCGAGATCCGCATTTTCCTTACTTTTGGCTACTTTTGGCTATTTTCCGGACGAGAT

Full Affymetrix probeset data:

Annotations for 1635551_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720