Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635552_s_at:

>probe:Drosophila_2:1635552_s_at:296:89; Interrogation_Position=1088; Antisense; AGTACACTAGCTAAGATCACATCCT
>probe:Drosophila_2:1635552_s_at:568:1; Interrogation_Position=643; Antisense; ATTAAGCTAGAACTGGGTCCCGATG
>probe:Drosophila_2:1635552_s_at:706:531; Interrogation_Position=691; Antisense; GGTGGCTACTTGGTGCGTCCCGACC
>probe:Drosophila_2:1635552_s_at:20:297; Interrogation_Position=711; Antisense; CGACCTCATTGAGTTCTGGCAGGGT
>probe:Drosophila_2:1635552_s_at:627:81; Interrogation_Position=731; Antisense; AGGGTCAGACCGATCGGCTCCACGA
>probe:Drosophila_2:1635552_s_at:633:449; Interrogation_Position=754; Antisense; GATCGCATCCGCTTTAGACGAGGTG
>probe:Drosophila_2:1635552_s_at:394:373; Interrogation_Position=793; Antisense; GAAGTCGACAGCAAACTGGTTCACA
>probe:Drosophila_2:1635552_s_at:681:721; Interrogation_Position=831; Antisense; TTGGGTGTACGAACGGCTGGCTCCT
>probe:Drosophila_2:1635552_s_at:359:141; Interrogation_Position=843; Antisense; ACGGCTGGCTCCTTAGGCACTGGGT
>probe:Drosophila_2:1635552_s_at:385:567; Interrogation_Position=858; Antisense; GGCACTGGGTTCTGGAGTTCAGCTA
>probe:Drosophila_2:1635552_s_at:658:585; Interrogation_Position=870; Antisense; TGGAGTTCAGCTACAGATGCATTGA
>probe:Drosophila_2:1635552_s_at:88:257; Interrogation_Position=905; Antisense; CAAATTAAGTTGTTATGCGCAGGAT
>probe:Drosophila_2:1635552_s_at:659:437; Interrogation_Position=934; Antisense; GAGGAACGTTTAAAGCTGCTTCAAA
>probe:Drosophila_2:1635552_s_at:162:491; Interrogation_Position=988; Antisense; GTACATCTGTACAAGCTTAACTACC

Paste this into a BLAST search page for me
AGTACACTAGCTAAGATCACATCCTATTAAGCTAGAACTGGGTCCCGATGGGTGGCTACTTGGTGCGTCCCGACCCGACCTCATTGAGTTCTGGCAGGGTAGGGTCAGACCGATCGGCTCCACGAGATCGCATCCGCTTTAGACGAGGTGGAAGTCGACAGCAAACTGGTTCACATTGGGTGTACGAACGGCTGGCTCCTACGGCTGGCTCCTTAGGCACTGGGTGGCACTGGGTTCTGGAGTTCAGCTATGGAGTTCAGCTACAGATGCATTGACAAATTAAGTTGTTATGCGCAGGATGAGGAACGTTTAAAGCTGCTTCAAAGTACATCTGTACAAGCTTAACTACC

Full Affymetrix probeset data:

Annotations for 1635552_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime