Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635553_at:

>probe:Drosophila_2:1635553_at:56:609; Interrogation_Position=111; Antisense; TGAGATTCCGAAGACCATCCTGATC
>probe:Drosophila_2:1635553_at:565:259; Interrogation_Position=126; Antisense; CATCCTGATCCAGAAAGTGCGACAG
>probe:Drosophila_2:1635553_at:558:65; Interrogation_Position=13; Antisense; ATGGTCTCCTTTGGCGGTGTGGCAA
>probe:Drosophila_2:1635553_at:417:399; Interrogation_Position=146; Antisense; GACAGGTGCCCCAGAATACCAGGGT
>probe:Drosophila_2:1635553_at:331:239; Interrogation_Position=160; Antisense; AATACCAGGGTGATACGCCAGAGAC
>probe:Drosophila_2:1635553_at:153:513; Interrogation_Position=169; Antisense; GTGATACGCCAGAGACCCCAAACCG
>probe:Drosophila_2:1635553_at:370:279; Interrogation_Position=18; Antisense; CTCCTTTGGCGGTGTGGCAAAACTA
>probe:Drosophila_2:1635553_at:640:249; Interrogation_Position=204; Antisense; CAAAAAATCCTCCAGCCAAAAGCGC
>probe:Drosophila_2:1635553_at:232:565; Interrogation_Position=33; Antisense; GGCAAAACTATTGAGCAGCTTCGAG
>probe:Drosophila_2:1635553_at:253:115; Interrogation_Position=49; Antisense; AGCTTCGAGTGCTGTGCCAGTTCGT
>probe:Drosophila_2:1635553_at:97:307; Interrogation_Position=64; Antisense; GCCAGTTCGTGGGTCAAAGCCGTAA
>probe:Drosophila_2:1635553_at:641:529; Interrogation_Position=74; Antisense; GGGTCAAAGCCGTAAATCCCGGATG
>probe:Drosophila_2:1635553_at:710:233; Interrogation_Position=88; Antisense; AATCCCGGATGGTACGAGGCTCGTG
>probe:Drosophila_2:1635553_at:711:487; Interrogation_Position=99; Antisense; GTACGAGGCTCGTGAGATTCCGAAG

Paste this into a BLAST search page for me
TGAGATTCCGAAGACCATCCTGATCCATCCTGATCCAGAAAGTGCGACAGATGGTCTCCTTTGGCGGTGTGGCAAGACAGGTGCCCCAGAATACCAGGGTAATACCAGGGTGATACGCCAGAGACGTGATACGCCAGAGACCCCAAACCGCTCCTTTGGCGGTGTGGCAAAACTACAAAAAATCCTCCAGCCAAAAGCGCGGCAAAACTATTGAGCAGCTTCGAGAGCTTCGAGTGCTGTGCCAGTTCGTGCCAGTTCGTGGGTCAAAGCCGTAAGGGTCAAAGCCGTAAATCCCGGATGAATCCCGGATGGTACGAGGCTCGTGGTACGAGGCTCGTGAGATTCCGAAG

Full Affymetrix probeset data:

Annotations for 1635553_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime