FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635554_at:

>probe:Drosophila_2:1635554_at:63:445; Interrogation_Position=108; Antisense; GTTCTGGTTACTACGGAAATCGCTT
>probe:Drosophila_2:1635554_at:508:557; Interrogation_Position=122; Antisense; GGAAATCGCTTAACGCTTGGCCGAC
>probe:Drosophila_2:1635554_at:619:713; Interrogation_Position=155; Antisense; TTCTCCGCGGGCGTGAAAACCGATC
>probe:Drosophila_2:1635554_at:297:179; Interrogation_Position=170; Antisense; AAAACCGATCTGACAAAAGCCGAAT
>probe:Drosophila_2:1635554_at:549:411; Interrogation_Position=18; Antisense; GACGCGCTCGCAATTAACCAAGGAC
>probe:Drosophila_2:1635554_at:204:175; Interrogation_Position=185; Antisense; AAAGCCGAATCACTCAGCGGCGGCA
>probe:Drosophila_2:1635554_at:104:329; Interrogation_Position=218; Antisense; GCGTAATGCCCCATGACAGGTGTCT
>probe:Drosophila_2:1635554_at:309:55; Interrogation_Position=230; Antisense; ATGACAGGTGTCTGCTCCAATCGCA
>probe:Drosophila_2:1635554_at:251:235; Interrogation_Position=248; Antisense; AATCGCAGTCATCCGTGAAGCACAT
>probe:Drosophila_2:1635554_at:9:49; Interrogation_Position=283; Antisense; ATCCACATTGGTTCCGAATTCAGAG
>probe:Drosophila_2:1635554_at:692:523; Interrogation_Position=308; Antisense; GGGCAAAACTCGGAAAGCGCTATGT
>probe:Drosophila_2:1635554_at:116:659; Interrogation_Position=32; Antisense; TAACCAAGGACCTCAACGCTAGTGA
>probe:Drosophila_2:1635554_at:617:123; Interrogation_Position=323; Antisense; AGCGCTATGTTCCACTTACTATGAT
>probe:Drosophila_2:1635554_at:21:361; Interrogation_Position=57; Antisense; GCAATACGATGGCTCCACAAACAAG

Paste this into a BLAST search page for me
GTTCTGGTTACTACGGAAATCGCTTGGAAATCGCTTAACGCTTGGCCGACTTCTCCGCGGGCGTGAAAACCGATCAAAACCGATCTGACAAAAGCCGAATGACGCGCTCGCAATTAACCAAGGACAAAGCCGAATCACTCAGCGGCGGCAGCGTAATGCCCCATGACAGGTGTCTATGACAGGTGTCTGCTCCAATCGCAAATCGCAGTCATCCGTGAAGCACATATCCACATTGGTTCCGAATTCAGAGGGGCAAAACTCGGAAAGCGCTATGTTAACCAAGGACCTCAACGCTAGTGAAGCGCTATGTTCCACTTACTATGATGCAATACGATGGCTCCACAAACAAG

Full Affymetrix probeset data:

Annotations for 1635554_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720