FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635555_at:

>probe:Drosophila_2:1635555_at:270:501; Interrogation_Position=1006; Antisense; GTCGTGGACTTCCTGAAGGAGCACT
>probe:Drosophila_2:1635555_at:160:685; Interrogation_Position=1042; Antisense; TATAGTGAGGTTGACCCTCCATCGG
>probe:Drosophila_2:1635555_at:192:41; Interrogation_Position=1062; Antisense; ATCGGCTGACTACACGGATTGCACG
>probe:Drosophila_2:1635555_at:638:347; Interrogation_Position=1143; Antisense; GCAGGCCTGGAGTTCGAAAAGCGAC
>probe:Drosophila_2:1635555_at:403:713; Interrogation_Position=1186; Antisense; TTCAGAGCACACCAGTTGACCGGAA
>probe:Drosophila_2:1635555_at:192:195; Interrogation_Position=1229; Antisense; AACTGGGAGGACTCTTTGGTGACGA
>probe:Drosophila_2:1635555_at:120:601; Interrogation_Position=777; Antisense; TGTAATGGCTGCTCGAGGCTTGCTT
>probe:Drosophila_2:1635555_at:64:439; Interrogation_Position=791; Antisense; GAGGCTTGCTTGCTAATCCGGCTCT
>probe:Drosophila_2:1635555_at:407:47; Interrogation_Position=806; Antisense; ATCCGGCTCTCTTCAATAGCAACTA
>probe:Drosophila_2:1635555_at:145:663; Interrogation_Position=840; Antisense; TAAAACAACGCCACTGTCCTGTGTA
>probe:Drosophila_2:1635555_at:30:339; Interrogation_Position=873; Antisense; GCTAGATATAGCCTCTGCTGCCGGG
>probe:Drosophila_2:1635555_at:429:31; Interrogation_Position=899; Antisense; ATAACCTGCTTTTCCAGTGCTTTCA
>probe:Drosophila_2:1635555_at:199:131; Interrogation_Position=929; Antisense; ACCTCACCTTTATGTATAGCGCTCA
>probe:Drosophila_2:1635555_at:311:453; Interrogation_Position=964; Antisense; GATCTTCGAGTGCAATTCAACAGTT

Paste this into a BLAST search page for me
GTCGTGGACTTCCTGAAGGAGCACTTATAGTGAGGTTGACCCTCCATCGGATCGGCTGACTACACGGATTGCACGGCAGGCCTGGAGTTCGAAAAGCGACTTCAGAGCACACCAGTTGACCGGAAAACTGGGAGGACTCTTTGGTGACGATGTAATGGCTGCTCGAGGCTTGCTTGAGGCTTGCTTGCTAATCCGGCTCTATCCGGCTCTCTTCAATAGCAACTATAAAACAACGCCACTGTCCTGTGTAGCTAGATATAGCCTCTGCTGCCGGGATAACCTGCTTTTCCAGTGCTTTCAACCTCACCTTTATGTATAGCGCTCAGATCTTCGAGTGCAATTCAACAGTT

Full Affymetrix probeset data:

Annotations for 1635555_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720