Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635557_at:

>probe:Drosophila_2:1635557_at:89:45; Interrogation_Position=2729; Antisense; ATCGCAGAATTTCCTTGGCTTCCTC
>probe:Drosophila_2:1635557_at:722:689; Interrogation_Position=2779; Antisense; TATTCCGATCCCTTTGCTTGTGTTG
>probe:Drosophila_2:1635557_at:324:217; Interrogation_Position=2829; Antisense; AAGTAGCTGTACTCGTTGGACTCCA
>probe:Drosophila_2:1635557_at:99:579; Interrogation_Position=2904; Antisense; GGCCTGTCGATGTTGTTGCTGTCCA
>probe:Drosophila_2:1635557_at:36:603; Interrogation_Position=2931; Antisense; TGTTCCACGGGTTCATCTCGAATGA
>probe:Drosophila_2:1635557_at:52:39; Interrogation_Position=2945; Antisense; ATCTCGAATGATCTGGGTGACCTTG
>probe:Drosophila_2:1635557_at:662:467; Interrogation_Position=2976; Antisense; GTATCGTCGGCCTTTAGAACGGGCA
>probe:Drosophila_2:1635557_at:440:561; Interrogation_Position=3013; Antisense; GGAACTTCAGCGTTTGGTTGCGAAT
>probe:Drosophila_2:1635557_at:61:221; Interrogation_Position=3105; Antisense; AAGGGATAGGGCTCCCCGAGTACAT
>probe:Drosophila_2:1635557_at:187:295; Interrogation_Position=3121; Antisense; CGAGTACATTTTGTCCCAGCGGATT
>probe:Drosophila_2:1635557_at:573:307; Interrogation_Position=3136; Antisense; CCAGCGGATTCTTGGGTATCTGACC
>probe:Drosophila_2:1635557_at:298:611; Interrogation_Position=3156; Antisense; TGACCCTTGTTTAGATCTCCGCAAA
>probe:Drosophila_2:1635557_at:237:597; Interrogation_Position=3184; Antisense; TGTGAACGGACACGGCAGACTTCTT
>probe:Drosophila_2:1635557_at:350:723; Interrogation_Position=3225; Antisense; TTGCACTCCGCATTTACAAAGGTGT

Paste this into a BLAST search page for me
ATCGCAGAATTTCCTTGGCTTCCTCTATTCCGATCCCTTTGCTTGTGTTGAAGTAGCTGTACTCGTTGGACTCCAGGCCTGTCGATGTTGTTGCTGTCCATGTTCCACGGGTTCATCTCGAATGAATCTCGAATGATCTGGGTGACCTTGGTATCGTCGGCCTTTAGAACGGGCAGGAACTTCAGCGTTTGGTTGCGAATAAGGGATAGGGCTCCCCGAGTACATCGAGTACATTTTGTCCCAGCGGATTCCAGCGGATTCTTGGGTATCTGACCTGACCCTTGTTTAGATCTCCGCAAATGTGAACGGACACGGCAGACTTCTTTTGCACTCCGCATTTACAAAGGTGT

Full Affymetrix probeset data:

Annotations for 1635557_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime