FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635560_at:

>probe:Drosophila_2:1635560_at:392:619; Interrogation_Position=1476; Antisense; TGCTCTATCACAAATTATTCCTGGG
>probe:Drosophila_2:1635560_at:390:271; Interrogation_Position=1583; Antisense; CATCTTATGCTGGAGCTATGGCCAA
>probe:Drosophila_2:1635560_at:452:245; Interrogation_Position=1627; Antisense; AATTATGGTCATTCCGCAGCTGTTT
>probe:Drosophila_2:1635560_at:512:353; Interrogation_Position=1642; Antisense; GCAGCTGTTTTAGCATTTTGCCAAA
>probe:Drosophila_2:1635560_at:630:681; Interrogation_Position=1674; Antisense; TATGTCTGCATCCTTTATATCTCCG
>probe:Drosophila_2:1635560_at:139:23; Interrogation_Position=1690; Antisense; ATATCTCCGCTAACGGCTGGATTTA
>probe:Drosophila_2:1635560_at:515:333; Interrogation_Position=1705; Antisense; GCTGGATTTATCGTCACACAAGAGG
>probe:Drosophila_2:1635560_at:198:265; Interrogation_Position=1798; Antisense; CAGTCAACGGGTAATGCTATTTATT
>probe:Drosophila_2:1635560_at:198:295; Interrogation_Position=1835; Antisense; CGAAGAGGAACGTTTTCGACCATAT
>probe:Drosophila_2:1635560_at:440:91; Interrogation_Position=1862; Antisense; AGTTATCACGATCACAGTTCGCCTG
>probe:Drosophila_2:1635560_at:636:33; Interrogation_Position=1872; Antisense; ATCACAGTTCGCCTGTCCGTATAAG
>probe:Drosophila_2:1635560_at:570:503; Interrogation_Position=1886; Antisense; GTCCGTATAAGCACCGAGTTCTCGA
>probe:Drosophila_2:1635560_at:58:429; Interrogation_Position=1901; Antisense; GAGTTCTCGACAACCACTAAAGCGC
>probe:Drosophila_2:1635560_at:427:319; Interrogation_Position=1924; Antisense; GCCGCAGCTCAAGCTTTTTTCAAAA

Paste this into a BLAST search page for me
TGCTCTATCACAAATTATTCCTGGGCATCTTATGCTGGAGCTATGGCCAAAATTATGGTCATTCCGCAGCTGTTTGCAGCTGTTTTAGCATTTTGCCAAATATGTCTGCATCCTTTATATCTCCGATATCTCCGCTAACGGCTGGATTTAGCTGGATTTATCGTCACACAAGAGGCAGTCAACGGGTAATGCTATTTATTCGAAGAGGAACGTTTTCGACCATATAGTTATCACGATCACAGTTCGCCTGATCACAGTTCGCCTGTCCGTATAAGGTCCGTATAAGCACCGAGTTCTCGAGAGTTCTCGACAACCACTAAAGCGCGCCGCAGCTCAAGCTTTTTTCAAAA

Full Affymetrix probeset data:

Annotations for 1635560_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720