FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635563_at:

>probe:Drosophila_2:1635563_at:694:721; Interrogation_Position=1441; Antisense; TTGCCCGTACCTACACAAGAAGCTG
>probe:Drosophila_2:1635563_at:66:97; Interrogation_Position=1479; Antisense; AGATTTGTATTGACTTTGTGCGCGG
>probe:Drosophila_2:1635563_at:75:725; Interrogation_Position=1514; Antisense; TTGGCTGCCGAGTGCAACAAACGTC
>probe:Drosophila_2:1635563_at:415:429; Interrogation_Position=1541; Antisense; GAGTTTTCCTGTCCCGAGTTGGAGC
>probe:Drosophila_2:1635563_at:335:361; Interrogation_Position=1580; Antisense; GAATTACCCAGGTGCGTGTTCTGTA
>probe:Drosophila_2:1635563_at:375:471; Interrogation_Position=1597; Antisense; GTTCTGTAAGAAGTCGCCATCAAAG
>probe:Drosophila_2:1635563_at:478:465; Interrogation_Position=1623; Antisense; GATTGGCCAAAGTCAAGTCGCGTCC
>probe:Drosophila_2:1635563_at:218:189; Interrogation_Position=1650; Antisense; AACTGGGCAGTAAACCTGTCGCCTT
>probe:Drosophila_2:1635563_at:51:667; Interrogation_Position=1699; Antisense; TACAGCGGATGAGTTGCCCACCAGT
>probe:Drosophila_2:1635563_at:443:691; Interrogation_Position=1733; Antisense; TTTGGGTCCCACAAGGAACCAGCGG
>probe:Drosophila_2:1635563_at:382:453; Interrogation_Position=1814; Antisense; GATCAGAAGGAAGCGGGTGCCCCTT
>probe:Drosophila_2:1635563_at:49:121; Interrogation_Position=1846; Antisense; ACGACGTCCTCAACTGGGAACTCTA
>probe:Drosophila_2:1635563_at:184:631; Interrogation_Position=1874; Antisense; TCTTTTATTCCCTTAGGTGGCGAAG
>probe:Drosophila_2:1635563_at:267:567; Interrogation_Position=1921; Antisense; GGCTATGGACCCAACGTTTCAGGTA

Paste this into a BLAST search page for me
TTGCCCGTACCTACACAAGAAGCTGAGATTTGTATTGACTTTGTGCGCGGTTGGCTGCCGAGTGCAACAAACGTCGAGTTTTCCTGTCCCGAGTTGGAGCGAATTACCCAGGTGCGTGTTCTGTAGTTCTGTAAGAAGTCGCCATCAAAGGATTGGCCAAAGTCAAGTCGCGTCCAACTGGGCAGTAAACCTGTCGCCTTTACAGCGGATGAGTTGCCCACCAGTTTTGGGTCCCACAAGGAACCAGCGGGATCAGAAGGAAGCGGGTGCCCCTTACGACGTCCTCAACTGGGAACTCTATCTTTTATTCCCTTAGGTGGCGAAGGGCTATGGACCCAACGTTTCAGGTA

Full Affymetrix probeset data:

Annotations for 1635563_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720