Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635564_at:

>probe:Drosophila_2:1635564_at:338:21; Interrogation_Position=1011; Antisense; ATATCTGCGCTCTCTTCTAAATTGG
>probe:Drosophila_2:1635564_at:155:481; Interrogation_Position=1082; Antisense; GTTTGGTTCATAACTCCAGACCAGT
>probe:Drosophila_2:1635564_at:696:413; Interrogation_Position=1100; Antisense; GACCAGTTTGGTCATCTGCAGCAAA
>probe:Drosophila_2:1635564_at:586:255; Interrogation_Position=1121; Antisense; CAAAAAATACCCTTGCTGCCTTGAT
>probe:Drosophila_2:1635564_at:527:283; Interrogation_Position=1136; Antisense; CTGCCTTGATGTATGCATGCTCCAA
>probe:Drosophila_2:1635564_at:518:243; Interrogation_Position=1161; Antisense; AATATCTTCGTATTTGCGCGCTTTG
>probe:Drosophila_2:1635564_at:248:323; Interrogation_Position=1191; Antisense; GCGCTTTATTAGTCCCACCTTTAGA
>probe:Drosophila_2:1635564_at:235:163; Interrogation_Position=1262; Antisense; AAATTCCATATCTGGTGACTCCGCT
>probe:Drosophila_2:1635564_at:597:263; Interrogation_Position=1317; Antisense; CAGCTCCGCCTCAATCTAAAGGTAT
>probe:Drosophila_2:1635564_at:491:521; Interrogation_Position=880; Antisense; GTGGCTGTGAAATCCCTACCAAGCA
>probe:Drosophila_2:1635564_at:260:209; Interrogation_Position=905; Antisense; AAGCTTCAGTGAATTCTGCTACGGA
>probe:Drosophila_2:1635564_at:365:495; Interrogation_Position=934; Antisense; GTCGCTAAAACACTTTCCCAGGGAT
>probe:Drosophila_2:1635564_at:13:83; Interrogation_Position=953; Antisense; AGGGATCACGAGCTGGACCATATTC
>probe:Drosophila_2:1635564_at:391:389; Interrogation_Position=984; Antisense; GAAAACAGTTTGGTCCTCAGCGGTT

Paste this into a BLAST search page for me
ATATCTGCGCTCTCTTCTAAATTGGGTTTGGTTCATAACTCCAGACCAGTGACCAGTTTGGTCATCTGCAGCAAACAAAAAATACCCTTGCTGCCTTGATCTGCCTTGATGTATGCATGCTCCAAAATATCTTCGTATTTGCGCGCTTTGGCGCTTTATTAGTCCCACCTTTAGAAAATTCCATATCTGGTGACTCCGCTCAGCTCCGCCTCAATCTAAAGGTATGTGGCTGTGAAATCCCTACCAAGCAAAGCTTCAGTGAATTCTGCTACGGAGTCGCTAAAACACTTTCCCAGGGATAGGGATCACGAGCTGGACCATATTCGAAAACAGTTTGGTCCTCAGCGGTT

Full Affymetrix probeset data:

Annotations for 1635564_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime