Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635568_at:

>probe:Drosophila_2:1635568_at:33:661; Interrogation_Position=4637; Antisense; TAACCTTCATGGCTCGGACAACGAT
>probe:Drosophila_2:1635568_at:715:65; Interrogation_Position=4690; Antisense; ATGGAGAGCCGCTGGACTCCGATGA
>probe:Drosophila_2:1635568_at:688:403; Interrogation_Position=4704; Antisense; GACTCCGATGACGATAGTGACGACG
>probe:Drosophila_2:1635568_at:116:571; Interrogation_Position=4734; Antisense; GGCTCCGACAATGGCGACGACGATG
>probe:Drosophila_2:1635568_at:85:139; Interrogation_Position=4753; Antisense; ACGATGGCGACTTTGATGTGCTGGA
>probe:Drosophila_2:1635568_at:660:441; Interrogation_Position=4767; Antisense; GATGTGCTGGAATACTTCGATAGAA
>probe:Drosophila_2:1635568_at:541:113; Interrogation_Position=4791; Antisense; AGCAGCTCAGACGATTGAGCCCACT
>probe:Drosophila_2:1635568_at:101:143; Interrogation_Position=4885; Antisense; ACTGTTTCGTCTCGTCTCGTTTGAA
>probe:Drosophila_2:1635568_at:502:477; Interrogation_Position=4903; Antisense; GTTTGAACCTCTTAGTTGTCCGCAG
>probe:Drosophila_2:1635568_at:686:677; Interrogation_Position=4915; Antisense; TAGTTGTCCGCAGCGCGCATGGAAG
>probe:Drosophila_2:1635568_at:112:445; Interrogation_Position=4940; Antisense; GATGAGCAAGCAACAGTCGTCGTAG
>probe:Drosophila_2:1635568_at:469:501; Interrogation_Position=4955; Antisense; GTCGTCGTAGCATAAGCACTCTAGA
>probe:Drosophila_2:1635568_at:554:349; Interrogation_Position=5047; Antisense; GCAGGATTGCATTAAAGCCAGCTAA
>probe:Drosophila_2:1635568_at:419:449; Interrogation_Position=5085; Antisense; GATCGCATAATGAGTACCAACTGTA

Paste this into a BLAST search page for me
TAACCTTCATGGCTCGGACAACGATATGGAGAGCCGCTGGACTCCGATGAGACTCCGATGACGATAGTGACGACGGGCTCCGACAATGGCGACGACGATGACGATGGCGACTTTGATGTGCTGGAGATGTGCTGGAATACTTCGATAGAAAGCAGCTCAGACGATTGAGCCCACTACTGTTTCGTCTCGTCTCGTTTGAAGTTTGAACCTCTTAGTTGTCCGCAGTAGTTGTCCGCAGCGCGCATGGAAGGATGAGCAAGCAACAGTCGTCGTAGGTCGTCGTAGCATAAGCACTCTAGAGCAGGATTGCATTAAAGCCAGCTAAGATCGCATAATGAGTACCAACTGTA

Full Affymetrix probeset data:

Annotations for 1635568_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime