FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635572_at:

>probe:Drosophila_2:1635572_at:420:7; Interrogation_Position=129; Antisense; ATTGCCGTCGTGGTTGATTGGATCT
>probe:Drosophila_2:1635572_at:211:269; Interrogation_Position=157; Antisense; CAGGCTTTGTTGTCATCCGGTGTAC
>probe:Drosophila_2:1635572_at:253:365; Interrogation_Position=209; Antisense; GAATATCGTCTGGTATGTTGTCGCC
>probe:Drosophila_2:1635572_at:567:25; Interrogation_Position=234; Antisense; ATAGTCCACATTGCCCACATAGTTT
>probe:Drosophila_2:1635572_at:253:473; Interrogation_Position=270; Antisense; GTTCTTGTTTCTCTTTGTGTGCGAA
>probe:Drosophila_2:1635572_at:128:181; Interrogation_Position=297; Antisense; AAAAATCTCGTAGCTCCCTATTTGA
>probe:Drosophila_2:1635572_at:352:161; Interrogation_Position=378; Antisense; AAATTGGGCGACCACGATATCCCGG
>probe:Drosophila_2:1635572_at:582:457; Interrogation_Position=393; Antisense; GATATCCCGGGACTGATTTTCATCA
>probe:Drosophila_2:1635572_at:173:7; Interrogation_Position=432; Antisense; ATTGCAGTCTGCTTGTGGATCGTTG
>probe:Drosophila_2:1635572_at:685:545; Interrogation_Position=448; Antisense; GGATCGTTGTCTTCTCGTGGTACAA
>probe:Drosophila_2:1635572_at:258:439; Interrogation_Position=481; Antisense; GAGGCTCAGCGGACATATAGATCAC
>probe:Drosophila_2:1635572_at:675:387; Interrogation_Position=529; Antisense; GAAAATGATCCCGAGACACCAAGTT
>probe:Drosophila_2:1635572_at:506:415; Interrogation_Position=608; Antisense; GAGCCTTGATTATCGCCCTTATAGA
>probe:Drosophila_2:1635572_at:497:611; Interrogation_Position=641; Antisense; TGACGGCGGCAGTTGTTTTGGAAAC

Paste this into a BLAST search page for me
ATTGCCGTCGTGGTTGATTGGATCTCAGGCTTTGTTGTCATCCGGTGTACGAATATCGTCTGGTATGTTGTCGCCATAGTCCACATTGCCCACATAGTTTGTTCTTGTTTCTCTTTGTGTGCGAAAAAAATCTCGTAGCTCCCTATTTGAAAATTGGGCGACCACGATATCCCGGGATATCCCGGGACTGATTTTCATCAATTGCAGTCTGCTTGTGGATCGTTGGGATCGTTGTCTTCTCGTGGTACAAGAGGCTCAGCGGACATATAGATCACGAAAATGATCCCGAGACACCAAGTTGAGCCTTGATTATCGCCCTTATAGATGACGGCGGCAGTTGTTTTGGAAAC

Full Affymetrix probeset data:

Annotations for 1635572_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720