Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635573_at:

>probe:Drosophila_2:1635573_at:465:109; Interrogation_Position=1086; Antisense; AGAAGACCAGGAACCCAGTTGCATC
>probe:Drosophila_2:1635573_at:150:239; Interrogation_Position=1120; Antisense; AATCAACGCCGCGAACTGGAGTCCA
>probe:Drosophila_2:1635573_at:516:261; Interrogation_Position=1143; Antisense; CACCGTGGTGTGTAGCGATAGCATC
>probe:Drosophila_2:1635573_at:586:325; Interrogation_Position=1157; Antisense; GCGATAGCATCAGCTGTGCCATGAT
>probe:Drosophila_2:1635573_at:475:131; Interrogation_Position=1209; Antisense; ACCGGCGCCTGGAATGGTTACCAAG
>probe:Drosophila_2:1635573_at:226:547; Interrogation_Position=1244; Antisense; GGATGCTGCTGAGACAGGCTTCCAC
>probe:Drosophila_2:1635573_at:113:435; Interrogation_Position=1311; Antisense; GAGGGTAACATCACCGGTTCATCCA
>probe:Drosophila_2:1635573_at:316:291; Interrogation_Position=1337; Antisense; CGGTGGCTGTCTCGCCCAAAAAGAA
>probe:Drosophila_2:1635573_at:328:197; Interrogation_Position=1374; Antisense; AACGGAGCCGCCAAAGAGTTGCCTG
>probe:Drosophila_2:1635573_at:152:129; Interrogation_Position=1414; Antisense; ACCAGAATTCCAACGAGCATCCATT
>probe:Drosophila_2:1635573_at:722:235; Interrogation_Position=1505; Antisense; AATCGCCACAGCAAAGGTCACCGGG
>probe:Drosophila_2:1635573_at:599:223; Interrogation_Position=1518; Antisense; AAGGTCACCGGGTCAGCAGACACAG
>probe:Drosophila_2:1635573_at:657:507; Interrogation_Position=1597; Antisense; GTGCGAAGATCCTACGCCAGTTAGG
>probe:Drosophila_2:1635573_at:22:475; Interrogation_Position=1616; Antisense; GTTAGGATCTATACGAGCACTGCTA

Paste this into a BLAST search page for me
AGAAGACCAGGAACCCAGTTGCATCAATCAACGCCGCGAACTGGAGTCCACACCGTGGTGTGTAGCGATAGCATCGCGATAGCATCAGCTGTGCCATGATACCGGCGCCTGGAATGGTTACCAAGGGATGCTGCTGAGACAGGCTTCCACGAGGGTAACATCACCGGTTCATCCACGGTGGCTGTCTCGCCCAAAAAGAAAACGGAGCCGCCAAAGAGTTGCCTGACCAGAATTCCAACGAGCATCCATTAATCGCCACAGCAAAGGTCACCGGGAAGGTCACCGGGTCAGCAGACACAGGTGCGAAGATCCTACGCCAGTTAGGGTTAGGATCTATACGAGCACTGCTA

Full Affymetrix probeset data:

Annotations for 1635573_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime