Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635576_at:

>probe:Drosophila_2:1635576_at:256:267; Interrogation_Position=15; Antisense; CAGTACTCAAGTCATCGTTCTCTAG
>probe:Drosophila_2:1635576_at:654:251; Interrogation_Position=169; Antisense; CAAGAATTTCTTACCAAGGCCCAGG
>probe:Drosophila_2:1635576_at:455:213; Interrogation_Position=184; Antisense; AAGGCCCAGGGTGATTTCAACGAAT
>probe:Drosophila_2:1635576_at:361:653; Interrogation_Position=21; Antisense; TCAAGTCATCGTTCTCTAGTTCAGA
>probe:Drosophila_2:1635576_at:87:373; Interrogation_Position=240; Antisense; GAAGGTTGAGGGTCTCTTCAAGGAT
>probe:Drosophila_2:1635576_at:475:547; Interrogation_Position=261; Antisense; GGATGGATTAAATACCGTGCAGGAG
>probe:Drosophila_2:1635576_at:423:69; Interrogation_Position=280; Antisense; CAGGAGGGTCTGCAAAAACTTAACG
>probe:Drosophila_2:1635576_at:80:125; Interrogation_Position=324; Antisense; AGCCGCATCCACCTAAGACGTTGTT
>probe:Drosophila_2:1635576_at:532:305; Interrogation_Position=335; Antisense; CCTAAGACGTTGTTGGATGGCCATA
>probe:Drosophila_2:1635576_at:236:547; Interrogation_Position=349; Antisense; GGATGGCCATATATCATTACATTGA
>probe:Drosophila_2:1635576_at:572:275; Interrogation_Position=36; Antisense; CTAGTTCAGAGTTCCGCAGCAGTTA
>probe:Drosophila_2:1635576_at:253:379; Interrogation_Position=44; Antisense; GAGTTCCGCAGCAGTTACAAAAAAC
>probe:Drosophila_2:1635576_at:7:229; Interrogation_Position=78; Antisense; AATGGCCAAGCTCGCAATTTGCATC
>probe:Drosophila_2:1635576_at:619:243; Interrogation_Position=93; Antisense; AATTTGCATCCTCGTGTTCGCCCTG

Paste this into a BLAST search page for me
CAGTACTCAAGTCATCGTTCTCTAGCAAGAATTTCTTACCAAGGCCCAGGAAGGCCCAGGGTGATTTCAACGAATTCAAGTCATCGTTCTCTAGTTCAGAGAAGGTTGAGGGTCTCTTCAAGGATGGATGGATTAAATACCGTGCAGGAGCAGGAGGGTCTGCAAAAACTTAACGAGCCGCATCCACCTAAGACGTTGTTCCTAAGACGTTGTTGGATGGCCATAGGATGGCCATATATCATTACATTGACTAGTTCAGAGTTCCGCAGCAGTTAGAGTTCCGCAGCAGTTACAAAAAACAATGGCCAAGCTCGCAATTTGCATCAATTTGCATCCTCGTGTTCGCCCTG

Full Affymetrix probeset data:

Annotations for 1635576_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime