FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635578_at:

>probe:Drosophila_2:1635578_at:378:531; Interrogation_Position=1031; Antisense; GGGTGGCGTACATACAAGTTCCCCA
>probe:Drosophila_2:1635578_at:704:215; Interrogation_Position=1046; Antisense; AAGTTCCCCACGCAATCTTTATGAC
>probe:Drosophila_2:1635578_at:231:683; Interrogation_Position=1065; Antisense; TATGACGCGCTTTATATTGGCTGAC
>probe:Drosophila_2:1635578_at:157:607; Interrogation_Position=1116; Antisense; TGAGGAACGCCCCAAGCTTACGGAC
>probe:Drosophila_2:1635578_at:473:587; Interrogation_Position=662; Antisense; TGGAGGACATTCGTCGAGCCACCAA
>probe:Drosophila_2:1635578_at:214:145; Interrogation_Position=692; Antisense; ACTCCAGACTTGTAGCCCGAATGAA
>probe:Drosophila_2:1635578_at:601:423; Interrogation_Position=718; Antisense; GAGTTGTCGGACCAGTTTTTTGAAT
>probe:Drosophila_2:1635578_at:121:701; Interrogation_Position=733; Antisense; TTTTTTGAATTCTTAGCAGCCGCCC
>probe:Drosophila_2:1635578_at:631:293; Interrogation_Position=768; Antisense; CGATGGGCCTTTTACCAGCATTATA
>probe:Drosophila_2:1635578_at:19:117; Interrogation_Position=784; Antisense; AGCATTATACACTGGCCCACTGGAA
>probe:Drosophila_2:1635578_at:89:287; Interrogation_Position=803; Antisense; CTGGAACACCCGTCGAGCTGAAAAT
>probe:Drosophila_2:1635578_at:472:711; Interrogation_Position=836; Antisense; TTCAGACGGCACAGTACGATTCAGT
>probe:Drosophila_2:1635578_at:627:401; Interrogation_Position=868; Antisense; GACATAATCTCGTTTTTGCTATCAA
>probe:Drosophila_2:1635578_at:133:73; Interrogation_Position=950; Antisense; AGGCTTTTGAGCGTTGTCTGCGACG

Paste this into a BLAST search page for me
GGGTGGCGTACATACAAGTTCCCCAAAGTTCCCCACGCAATCTTTATGACTATGACGCGCTTTATATTGGCTGACTGAGGAACGCCCCAAGCTTACGGACTGGAGGACATTCGTCGAGCCACCAAACTCCAGACTTGTAGCCCGAATGAAGAGTTGTCGGACCAGTTTTTTGAATTTTTTTGAATTCTTAGCAGCCGCCCCGATGGGCCTTTTACCAGCATTATAAGCATTATACACTGGCCCACTGGAACTGGAACACCCGTCGAGCTGAAAATTTCAGACGGCACAGTACGATTCAGTGACATAATCTCGTTTTTGCTATCAAAGGCTTTTGAGCGTTGTCTGCGACG

Full Affymetrix probeset data:

Annotations for 1635578_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720