Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635580_at:

>probe:Drosophila_2:1635580_at:50:245; Interrogation_Position=3380; Antisense; AATTCCCAGATTATAGCGAACCCAT
>probe:Drosophila_2:1635580_at:342:325; Interrogation_Position=3395; Antisense; GCGAACCCATCGTTAAACGCTAGTG
>probe:Drosophila_2:1635580_at:652:243; Interrogation_Position=3502; Antisense; AATATTTTCGATTTAGGAGCACCAA
>probe:Drosophila_2:1635580_at:6:553; Interrogation_Position=3517; Antisense; GGAGCACCAAAATACACGCCTGTAC
>probe:Drosophila_2:1635580_at:193:15; Interrogation_Position=3548; Antisense; ATTAGGCTGGGCTATGCGATCCCAG
>probe:Drosophila_2:1635580_at:669:619; Interrogation_Position=3562; Antisense; TGCGATCCCAGGAGATTGAGTCCTT
>probe:Drosophila_2:1635580_at:577:463; Interrogation_Position=3575; Antisense; GATTGAGTCCTTGAAATTCCCCACT
>probe:Drosophila_2:1635580_at:220:387; Interrogation_Position=3587; Antisense; GAAATTCCCCACTTGGCGTAGCCAG
>probe:Drosophila_2:1635580_at:371:127; Interrogation_Position=3606; Antisense; AGCCAGCACAAGCAATTCACGTTTC
>probe:Drosophila_2:1635580_at:575:385; Interrogation_Position=3689; Antisense; GAAATTTAAGCACAACCCTTGGATA
>probe:Drosophila_2:1635580_at:17:405; Interrogation_Position=3743; Antisense; GACTATCTAACTTCTTCCTATTAAG
>probe:Drosophila_2:1635580_at:442:191; Interrogation_Position=3793; Antisense; AACTTGTATTTACGCAGTTCTGGAA
>probe:Drosophila_2:1635580_at:171:471; Interrogation_Position=3809; Antisense; GTTCTGGAAGAAACACTTGCCCACC
>probe:Drosophila_2:1635580_at:170:13; Interrogation_Position=3858; Antisense; ATTCAAATTTTCTTGCTCTCACAAA

Paste this into a BLAST search page for me
AATTCCCAGATTATAGCGAACCCATGCGAACCCATCGTTAAACGCTAGTGAATATTTTCGATTTAGGAGCACCAAGGAGCACCAAAATACACGCCTGTACATTAGGCTGGGCTATGCGATCCCAGTGCGATCCCAGGAGATTGAGTCCTTGATTGAGTCCTTGAAATTCCCCACTGAAATTCCCCACTTGGCGTAGCCAGAGCCAGCACAAGCAATTCACGTTTCGAAATTTAAGCACAACCCTTGGATAGACTATCTAACTTCTTCCTATTAAGAACTTGTATTTACGCAGTTCTGGAAGTTCTGGAAGAAACACTTGCCCACCATTCAAATTTTCTTGCTCTCACAAA

Full Affymetrix probeset data:

Annotations for 1635580_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime