FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635581_at:

>probe:Drosophila_2:1635581_at:538:575; Interrogation_Position=473; Antisense; GGCGACAAATGCTACGACGTCCATT
>probe:Drosophila_2:1635581_at:590:593; Interrogation_Position=519; Antisense; TGGGACCACGCCTGCGTTACAAGGC
>probe:Drosophila_2:1635581_at:324:69; Interrogation_Position=540; Antisense; AGGCCAGCAGGATGGGCAACCGATT
>probe:Drosophila_2:1635581_at:491:629; Interrogation_Position=564; Antisense; TCCTGGCCGGCATCGACTATGTGGG
>probe:Drosophila_2:1635581_at:140:129; Interrogation_Position=617; Antisense; ACCAGCAGCAAGTATGCCAGCGAAT
>probe:Drosophila_2:1635581_at:249:421; Interrogation_Position=644; Antisense; GAGAACTACCACAGGGCCAAGGAGC
>probe:Drosophila_2:1635581_at:190:421; Interrogation_Position=665; Antisense; GAGCACGGCGACGAGGACCTTGACA
>probe:Drosophila_2:1635581_at:541:437; Interrogation_Position=677; Antisense; GAGGACCTTGACAATTGGCACCCGC
>probe:Drosophila_2:1635581_at:256:599; Interrogation_Position=708; Antisense; TGTCGACCACGACCAGTAGCAGCAA
>probe:Drosophila_2:1635581_at:591:391; Interrogation_Position=764; Antisense; GAAACCATCGTCCTATGCGAACCAA
>probe:Drosophila_2:1635581_at:657:221; Interrogation_Position=865; Antisense; AAGGTGGCGATTTTCTTGGCAGGAA
>probe:Drosophila_2:1635581_at:354:53; Interrogation_Position=901; Antisense; ATGCTCATGGAGTACTGGCGACACT
>probe:Drosophila_2:1635581_at:445:287; Interrogation_Position=915; Antisense; CTGGCGACACTTGGAGACTCTTTTA
>probe:Drosophila_2:1635581_at:215:637; Interrogation_Position=990; Antisense; TCGACACTTTATTCGCTAGCAAATA

Paste this into a BLAST search page for me
GGCGACAAATGCTACGACGTCCATTTGGGACCACGCCTGCGTTACAAGGCAGGCCAGCAGGATGGGCAACCGATTTCCTGGCCGGCATCGACTATGTGGGACCAGCAGCAAGTATGCCAGCGAATGAGAACTACCACAGGGCCAAGGAGCGAGCACGGCGACGAGGACCTTGACAGAGGACCTTGACAATTGGCACCCGCTGTCGACCACGACCAGTAGCAGCAAGAAACCATCGTCCTATGCGAACCAAAAGGTGGCGATTTTCTTGGCAGGAAATGCTCATGGAGTACTGGCGACACTCTGGCGACACTTGGAGACTCTTTTATCGACACTTTATTCGCTAGCAAATA

Full Affymetrix probeset data:

Annotations for 1635581_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720