Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635585_at:

>probe:Drosophila_2:1635585_at:501:557; Interrogation_Position=2137; Antisense; GGACTCATTCTGGTGATCAGATGCG
>probe:Drosophila_2:1635585_at:396:281; Interrogation_Position=2140; Antisense; CTCATTCTGGTGATCAGATGCGATA
>probe:Drosophila_2:1635585_at:199:287; Interrogation_Position=2146; Antisense; CTGGTGATCAGATGCGATAAATACT
>probe:Drosophila_2:1635585_at:395:447; Interrogation_Position=2156; Antisense; GATGCGATAAATACTGTTGCAATTG
>probe:Drosophila_2:1635585_at:294:469; Interrogation_Position=2171; Antisense; GTTGCAATTGTTTTGAGCACACCAC
>probe:Drosophila_2:1635585_at:23:363; Interrogation_Position=2174; Antisense; GCAATTGTTTTGAGCACACCACCAT
>probe:Drosophila_2:1635585_at:200:249; Interrogation_Position=2176; Antisense; AATTGTTTTGAGCACACCACCATAA
>probe:Drosophila_2:1635585_at:262:723; Interrogation_Position=2178; Antisense; TTGTTTTGAGCACACCACCATAATG
>probe:Drosophila_2:1635585_at:682:475; Interrogation_Position=2180; Antisense; GTTTTGAGCACACCACCATAATGAA
>probe:Drosophila_2:1635585_at:225:691; Interrogation_Position=2182; Antisense; TTTGAGCACACCACCATAATGAATG
>probe:Drosophila_2:1635585_at:428:421; Interrogation_Position=2185; Antisense; GAGCACACCACCATAATGAATGCCC
>probe:Drosophila_2:1635585_at:286:129; Interrogation_Position=2194; Antisense; ACCATAATGAATGCCCAGCTGATAC
>probe:Drosophila_2:1635585_at:592:231; Interrogation_Position=2199; Antisense; AATGAATGCCCAGCTGATACCTAGT
>probe:Drosophila_2:1635585_at:510:615; Interrogation_Position=2201; Antisense; TGAATGCCCAGCTGATACCTAGTGT

Paste this into a BLAST search page for me
GGACTCATTCTGGTGATCAGATGCGCTCATTCTGGTGATCAGATGCGATACTGGTGATCAGATGCGATAAATACTGATGCGATAAATACTGTTGCAATTGGTTGCAATTGTTTTGAGCACACCACGCAATTGTTTTGAGCACACCACCATAATTGTTTTGAGCACACCACCATAATTGTTTTGAGCACACCACCATAATGGTTTTGAGCACACCACCATAATGAATTTGAGCACACCACCATAATGAATGGAGCACACCACCATAATGAATGCCCACCATAATGAATGCCCAGCTGATACAATGAATGCCCAGCTGATACCTAGTTGAATGCCCAGCTGATACCTAGTGT

Full Affymetrix probeset data:

Annotations for 1635585_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime