FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635588_at:

>probe:Drosophila_2:1635588_at:51:505; Interrogation_Position=134; Antisense; GTCCGGCGGAGATCTGAAGAACGAT
>probe:Drosophila_2:1635588_at:146:101; Interrogation_Position=200; Antisense; AGAGACCATCGACGAGTCCTTCATG
>probe:Drosophila_2:1635588_at:161:437; Interrogation_Position=242; Antisense; GAGGATCACCATCGATTACGAGCAT
>probe:Drosophila_2:1635588_at:38:671; Interrogation_Position=258; Antisense; TACGAGCATCACTACTACAGCATCT
>probe:Drosophila_2:1635588_at:671:345; Interrogation_Position=277; Antisense; GCATCTGCATGTCCAACCGTAGAAT
>probe:Drosophila_2:1635588_at:698:165; Interrogation_Position=321; Antisense; AAATCGCAGAATGGCGTCACCACGA
>probe:Drosophila_2:1635588_at:335:121; Interrogation_Position=369; Antisense; AGCGTGTATAACGATGCCAGCGATT
>probe:Drosophila_2:1635588_at:317:567; Interrogation_Position=398; Antisense; GGCAGTGCTGGCTTGAAATCCGTCG
>probe:Drosophila_2:1635588_at:83:613; Interrogation_Position=411; Antisense; TGAAATCCGTCGTCGGATGTCCGAC
>probe:Drosophila_2:1635588_at:508:411; Interrogation_Position=433; Antisense; GACCCACTTGCAGATTCTGTTGGCA
>probe:Drosophila_2:1635588_at:338:559; Interrogation_Position=465; Antisense; GGACAAAGACCCCACAATTGGCGCA
>probe:Drosophila_2:1635588_at:649:247; Interrogation_Position=480; Antisense; AATTGGCGCACTCCCATTATTTACC
>probe:Drosophila_2:1635588_at:443:703; Interrogation_Position=496; Antisense; TTATTTACCTAATCCTCCTCTTTAT
>probe:Drosophila_2:1635588_at:730:29; Interrogation_Position=531; Antisense; ATACATCATCTGTGAGCTCTTGCTC

Paste this into a BLAST search page for me
GTCCGGCGGAGATCTGAAGAACGATAGAGACCATCGACGAGTCCTTCATGGAGGATCACCATCGATTACGAGCATTACGAGCATCACTACTACAGCATCTGCATCTGCATGTCCAACCGTAGAATAAATCGCAGAATGGCGTCACCACGAAGCGTGTATAACGATGCCAGCGATTGGCAGTGCTGGCTTGAAATCCGTCGTGAAATCCGTCGTCGGATGTCCGACGACCCACTTGCAGATTCTGTTGGCAGGACAAAGACCCCACAATTGGCGCAAATTGGCGCACTCCCATTATTTACCTTATTTACCTAATCCTCCTCTTTATATACATCATCTGTGAGCTCTTGCTC

Full Affymetrix probeset data:

Annotations for 1635588_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720