Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635589_at:

>probe:Drosophila_2:1635589_at:536:651; Interrogation_Position=1427; Antisense; TCAACAGCTGCATCGAGGTGGATCT
>probe:Drosophila_2:1635589_at:222:587; Interrogation_Position=1455; Antisense; TGGACAGGTGTGCTCAGACTCGATT
>probe:Drosophila_2:1635589_at:487:399; Interrogation_Position=1508; Antisense; GACAGGTGGACTTCATTCGCGGAGC
>probe:Drosophila_2:1635589_at:398:499; Interrogation_Position=1541; Antisense; GTCTCGATGGACTGGGTGTGCCAAT
>probe:Drosophila_2:1635589_at:704:505; Interrogation_Position=1558; Antisense; GTGCCAATTATTGCCATGCCATCGA
>probe:Drosophila_2:1635589_at:686:423; Interrogation_Position=1597; Antisense; GAGAGCAAGATTGTTCCCACGCTGA
>probe:Drosophila_2:1635589_at:254:499; Interrogation_Position=1666; Antisense; GTCGTCACGGAGCATGGAATCGCCT
>probe:Drosophila_2:1635589_at:625:365; Interrogation_Position=1682; Antisense; GAATCGCCTCGCTGTTCGGCAAGAA
>probe:Drosophila_2:1635589_at:390:425; Interrogation_Position=1759; Antisense; GAGACCCTGGAGAAACAAGCCTTCG
>probe:Drosophila_2:1635589_at:251:33; Interrogation_Position=1840; Antisense; ATCACTATTTACTAGCAGCGACCCG
>probe:Drosophila_2:1635589_at:687:121; Interrogation_Position=1856; Antisense; AGCGACCCGCAATCTTTGAAGGCAT
>probe:Drosophila_2:1635589_at:502:689; Interrogation_Position=1870; Antisense; TTTGAAGGCATTCCCGATATCGCTT
>probe:Drosophila_2:1635589_at:238:457; Interrogation_Position=1885; Antisense; GATATCGCTTTGATCCACTTCATAG
>probe:Drosophila_2:1635589_at:583:603; Interrogation_Position=1921; Antisense; TGATAGCCCTTTAGCATTACCAAAT

Paste this into a BLAST search page for me
TCAACAGCTGCATCGAGGTGGATCTTGGACAGGTGTGCTCAGACTCGATTGACAGGTGGACTTCATTCGCGGAGCGTCTCGATGGACTGGGTGTGCCAATGTGCCAATTATTGCCATGCCATCGAGAGAGCAAGATTGTTCCCACGCTGAGTCGTCACGGAGCATGGAATCGCCTGAATCGCCTCGCTGTTCGGCAAGAAGAGACCCTGGAGAAACAAGCCTTCGATCACTATTTACTAGCAGCGACCCGAGCGACCCGCAATCTTTGAAGGCATTTTGAAGGCATTCCCGATATCGCTTGATATCGCTTTGATCCACTTCATAGTGATAGCCCTTTAGCATTACCAAAT

Full Affymetrix probeset data:

Annotations for 1635589_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime