Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635590_a_at:

>probe:Drosophila_2:1635590_a_at:624:7; Interrogation_Position=232; Antisense; ATTCCGAACTCCCAGTTGAATGTGG
>probe:Drosophila_2:1635590_a_at:663:63; Interrogation_Position=251; Antisense; ATGTGGATCTGAAGGCGCTGGACAA
>probe:Drosophila_2:1635590_a_at:218:591; Interrogation_Position=278; Antisense; TGGTAAGCACTCTTCTGGAGCAGCA
>probe:Drosophila_2:1635590_a_at:94:255; Interrogation_Position=301; Antisense; CACACTTCGGGTGCCAAGGGAGCCA
>probe:Drosophila_2:1635590_a_at:63:371; Interrogation_Position=371; Antisense; GAATGGCCTCCAAGAAGCTGAACCG
>probe:Drosophila_2:1635590_a_at:721:107; Interrogation_Position=383; Antisense; AGAAGCTGAACCGTTGGCGTCCACT
>probe:Drosophila_2:1635590_a_at:405:263; Interrogation_Position=423; Antisense; CAGCTACAAGCGTCACGAGAGCAGT
>probe:Drosophila_2:1635590_a_at:660:349; Interrogation_Position=443; Antisense; GCAGTGATCTCATCGGTGGTAGCTT
>probe:Drosophila_2:1635590_a_at:326:713; Interrogation_Position=466; Antisense; TTCACCCAGCTGATGGAGCGCGTTG
>probe:Drosophila_2:1635590_a_at:554:385; Interrogation_Position=567; Antisense; GAACAATGCCCAGCAACAGGCGGGT
>probe:Drosophila_2:1635590_a_at:585:537; Interrogation_Position=589; Antisense; GGTCATCCGCCCATGTGGAATGCAT
>probe:Drosophila_2:1635590_a_at:423:563; Interrogation_Position=604; Antisense; TGGAATGCATCCTTGGACGCGACGC
>probe:Drosophila_2:1635590_a_at:334:283; Interrogation_Position=649; Antisense; CTGCACGGAGCAGCTAGTGGAGCCA
>probe:Drosophila_2:1635590_a_at:514:437; Interrogation_Position=679; Antisense; GAGGCCGAGGATCAGCTCAATTTGA

Paste this into a BLAST search page for me
ATTCCGAACTCCCAGTTGAATGTGGATGTGGATCTGAAGGCGCTGGACAATGGTAAGCACTCTTCTGGAGCAGCACACACTTCGGGTGCCAAGGGAGCCAGAATGGCCTCCAAGAAGCTGAACCGAGAAGCTGAACCGTTGGCGTCCACTCAGCTACAAGCGTCACGAGAGCAGTGCAGTGATCTCATCGGTGGTAGCTTTTCACCCAGCTGATGGAGCGCGTTGGAACAATGCCCAGCAACAGGCGGGTGGTCATCCGCCCATGTGGAATGCATTGGAATGCATCCTTGGACGCGACGCCTGCACGGAGCAGCTAGTGGAGCCAGAGGCCGAGGATCAGCTCAATTTGA

Full Affymetrix probeset data:

Annotations for 1635590_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime