Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635592_at:

>probe:Drosophila_2:1635592_at:107:703; Interrogation_Position=4018; Antisense; TTATTCCTAAGCTTTTCAATGTCAT
>probe:Drosophila_2:1635592_at:242:707; Interrogation_Position=4044; Antisense; TTAGCTGCATTAATTGGTGTCATCA
>probe:Drosophila_2:1635592_at:67:281; Interrogation_Position=4088; Antisense; CTAAGCCCCGCTTGAATGAAAGTTG
>probe:Drosophila_2:1635592_at:492:697; Interrogation_Position=4141; Antisense; TTTCTAACTATTTCGCACAGCACTA
>probe:Drosophila_2:1635592_at:180:699; Interrogation_Position=4182; Antisense; TTTTTTATGCGCACCAAGCACCGGA
>probe:Drosophila_2:1635592_at:257:113; Interrogation_Position=4198; Antisense; AGCACCGGAGCAACAATAGATTTAA
>probe:Drosophila_2:1635592_at:313:341; Interrogation_Position=4239; Antisense; GCTAGGCTAGAGTGTCGGTTTCAAA
>probe:Drosophila_2:1635592_at:82:211; Interrogation_Position=4323; Antisense; AAGACACTTCGATTTCATTTCGTCG
>probe:Drosophila_2:1635592_at:615:659; Interrogation_Position=4367; Antisense; TAACGTTAGCGATTCCCAAAGCCAA
>probe:Drosophila_2:1635592_at:143:175; Interrogation_Position=4384; Antisense; AAAGCCAAAGCTGCATTTATCACCA
>probe:Drosophila_2:1635592_at:445:17; Interrogation_Position=4398; Antisense; ATTTATCACCAGCTGCTATAGCCGT
>probe:Drosophila_2:1635592_at:149:697; Interrogation_Position=4455; Antisense; TTTCGCATCGGCAGCTCCAAAATTA
>probe:Drosophila_2:1635592_at:214:247; Interrogation_Position=4505; Antisense; AATTGCAAATTGTCGCATCCAGTTT
>probe:Drosophila_2:1635592_at:537:527; Interrogation_Position=4579; Antisense; GGGAAATCGACGAGAGCGCTCCCCT

Paste this into a BLAST search page for me
TTATTCCTAAGCTTTTCAATGTCATTTAGCTGCATTAATTGGTGTCATCACTAAGCCCCGCTTGAATGAAAGTTGTTTCTAACTATTTCGCACAGCACTATTTTTTATGCGCACCAAGCACCGGAAGCACCGGAGCAACAATAGATTTAAGCTAGGCTAGAGTGTCGGTTTCAAAAAGACACTTCGATTTCATTTCGTCGTAACGTTAGCGATTCCCAAAGCCAAAAAGCCAAAGCTGCATTTATCACCAATTTATCACCAGCTGCTATAGCCGTTTTCGCATCGGCAGCTCCAAAATTAAATTGCAAATTGTCGCATCCAGTTTGGGAAATCGACGAGAGCGCTCCCCT

Full Affymetrix probeset data:

Annotations for 1635592_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime