FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635593_at:

>probe:Drosophila_2:1635593_at:662:91; Interrogation_Position=1224; Antisense; AGTTTCTGGACATCTGCATCATGGA
>probe:Drosophila_2:1635593_at:580:523; Interrogation_Position=1268; Antisense; GGGCTACCATTCCTCAATCGAGAGT
>probe:Drosophila_2:1635593_at:99:425; Interrogation_Position=1287; Antisense; GAGAGTGCACCGAAGATTATCCCGT
>probe:Drosophila_2:1635593_at:726:61; Interrogation_Position=1300; Antisense; AGATTATCCCGTACCTGGAACTAAT
>probe:Drosophila_2:1635593_at:507:715; Interrogation_Position=1350; Antisense; TTCTGATCTCGCTCTTTGGCATGCA
>probe:Drosophila_2:1635593_at:691:53; Interrogation_Position=1370; Antisense; ATGCAGCGTGATCCCGTCTATTTTC
>probe:Drosophila_2:1635593_at:151:47; Interrogation_Position=1413; Antisense; ATCCCCATCGCTTCGATTCAAATAA
>probe:Drosophila_2:1635593_at:190:427; Interrogation_Position=1473; Antisense; GAGAGGGTCCTAGGCACTGCATAGC
>probe:Drosophila_2:1635593_at:620:143; Interrogation_Position=1488; Antisense; ACTGCATAGCTCTTCGCATGGGAAA
>probe:Drosophila_2:1635593_at:644:491; Interrogation_Position=1514; Antisense; GTCAACTCCAAGGTGGCGGTGGCTA
>probe:Drosophila_2:1635593_at:523:725; Interrogation_Position=1554; Antisense; TTGATCTGGTTCAATCTCCACGCAA
>probe:Drosophila_2:1635593_at:695:75; Interrogation_Position=1581; Antisense; AGGTGGAGTTCCGTTTCGATGCCGC
>probe:Drosophila_2:1635593_at:602:47; Interrogation_Position=1599; Antisense; ATGCCGCCCCTGTTTTAGTGACCAA
>probe:Drosophila_2:1635593_at:269:225; Interrogation_Position=1622; Antisense; AAGGAGCCGTTGAAGCTGCGCTTGA

Paste this into a BLAST search page for me
AGTTTCTGGACATCTGCATCATGGAGGGCTACCATTCCTCAATCGAGAGTGAGAGTGCACCGAAGATTATCCCGTAGATTATCCCGTACCTGGAACTAATTTCTGATCTCGCTCTTTGGCATGCAATGCAGCGTGATCCCGTCTATTTTCATCCCCATCGCTTCGATTCAAATAAGAGAGGGTCCTAGGCACTGCATAGCACTGCATAGCTCTTCGCATGGGAAAGTCAACTCCAAGGTGGCGGTGGCTATTGATCTGGTTCAATCTCCACGCAAAGGTGGAGTTCCGTTTCGATGCCGCATGCCGCCCCTGTTTTAGTGACCAAAAGGAGCCGTTGAAGCTGCGCTTGA

Full Affymetrix probeset data:

Annotations for 1635593_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720