FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635594_at:

>probe:Drosophila_2:1635594_at:246:151; Interrogation_Position=243; Antisense; ACAGGCGACGGCATTTCGGGTCCTA
>probe:Drosophila_2:1635594_at:56:697; Interrogation_Position=256; Antisense; TTTCGGGTCCTAACAGGCACACAGG
>probe:Drosophila_2:1635594_at:558:353; Interrogation_Position=343; Antisense; GCACCACGCAAGTATCGCAACGATA
>probe:Drosophila_2:1635594_at:182:23; Interrogation_Position=365; Antisense; ATATAGCTTTACTGCATCTGAATGA
>probe:Drosophila_2:1635594_at:189:481; Interrogation_Position=399; Antisense; GTTTGATAATGCCACTCAACCGGTG
>probe:Drosophila_2:1635594_at:212:455; Interrogation_Position=430; Antisense; GATCACGAGGCCTTGGTTCCAGGAT
>probe:Drosophila_2:1635594_at:30:501; Interrogation_Position=521; Antisense; GTCTGGAGGTCAACTATGTGCCCTT
>probe:Drosophila_2:1635594_at:425:681; Interrogation_Position=535; Antisense; TATGTGCCCTTCGAGCAGTGTCGAG
>probe:Drosophila_2:1635594_at:696:23; Interrogation_Position=572; Antisense; ATAGCACTCGGGTGGACATTGGCCA
>probe:Drosophila_2:1635594_at:577:251; Interrogation_Position=669; Antisense; CAAGCTGGTGGCTCTGGTCAACTGG
>probe:Drosophila_2:1635594_at:31:225; Interrogation_Position=710; Antisense; AAGGATATCCAGATGCTCACGCTTC
>probe:Drosophila_2:1635594_at:219:447; Interrogation_Position=721; Antisense; GATGCTCACGCTTCAATTTCATATT
>probe:Drosophila_2:1635594_at:542:703; Interrogation_Position=744; Antisense; TTATCACGACTTTATACGCACTCAC
>probe:Drosophila_2:1635594_at:560:437; Interrogation_Position=808; Antisense; GAGGAAATGATTGCTCTCCAGGATT

Paste this into a BLAST search page for me
ACAGGCGACGGCATTTCGGGTCCTATTTCGGGTCCTAACAGGCACACAGGGCACCACGCAAGTATCGCAACGATAATATAGCTTTACTGCATCTGAATGAGTTTGATAATGCCACTCAACCGGTGGATCACGAGGCCTTGGTTCCAGGATGTCTGGAGGTCAACTATGTGCCCTTTATGTGCCCTTCGAGCAGTGTCGAGATAGCACTCGGGTGGACATTGGCCACAAGCTGGTGGCTCTGGTCAACTGGAAGGATATCCAGATGCTCACGCTTCGATGCTCACGCTTCAATTTCATATTTTATCACGACTTTATACGCACTCACGAGGAAATGATTGCTCTCCAGGATT

Full Affymetrix probeset data:

Annotations for 1635594_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720