FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635595_at:

>probe:Drosophila_2:1635595_at:705:219; Interrogation_Position=1030; Antisense; AAGTGCACCCGCTATTGGCAACATT
>probe:Drosophila_2:1635595_at:601:357; Interrogation_Position=1047; Antisense; GCAACATTGTGGCTTTAGTCTTCAG
>probe:Drosophila_2:1635595_at:271:497; Interrogation_Position=1064; Antisense; GTCTTCAGCTACTTAACTATCCGGA
>probe:Drosophila_2:1635595_at:398:543; Interrogation_Position=1104; Antisense; GGATTTTCCACGCATCTTCATCAAT
>probe:Drosophila_2:1635595_at:144:249; Interrogation_Position=1125; Antisense; CAATCCGGGCGAGCATTATTTCCAT
>probe:Drosophila_2:1635595_at:251:129; Interrogation_Position=1153; Antisense; ACCATCTACCATTTTGGCGTTCAGG
>probe:Drosophila_2:1635595_at:462:167; Interrogation_Position=1186; Antisense; AAATGCTGTGCCGATCCGGAGGAAC
>probe:Drosophila_2:1635595_at:231:139; Interrogation_Position=779; Antisense; ACGATATCCGATTGCCAGTATTCAT
>probe:Drosophila_2:1635595_at:245:689; Interrogation_Position=797; Antisense; TATTCATGGGCGACCGAGTGCGTCA
>probe:Drosophila_2:1635595_at:295:671; Interrogation_Position=847; Antisense; TACGATGTTTGCTTTGCTCTCGACA
>probe:Drosophila_2:1635595_at:504:595; Interrogation_Position=900; Antisense; TGTGGGCAGATTTTTGCATCCGGAT
>probe:Drosophila_2:1635595_at:504:243; Interrogation_Position=942; Antisense; AATATTCAGCAATCAGCCGTGTGTT
>probe:Drosophila_2:1635595_at:246:513; Interrogation_Position=962; Antisense; GTGTTAAATTCACCACCGGCAATTG
>probe:Drosophila_2:1635595_at:514:699; Interrogation_Position=987; Antisense; TTTTCCCCAGGAACCGCTTGGTGAG

Paste this into a BLAST search page for me
AAGTGCACCCGCTATTGGCAACATTGCAACATTGTGGCTTTAGTCTTCAGGTCTTCAGCTACTTAACTATCCGGAGGATTTTCCACGCATCTTCATCAATCAATCCGGGCGAGCATTATTTCCATACCATCTACCATTTTGGCGTTCAGGAAATGCTGTGCCGATCCGGAGGAACACGATATCCGATTGCCAGTATTCATTATTCATGGGCGACCGAGTGCGTCATACGATGTTTGCTTTGCTCTCGACATGTGGGCAGATTTTTGCATCCGGATAATATTCAGCAATCAGCCGTGTGTTGTGTTAAATTCACCACCGGCAATTGTTTTCCCCAGGAACCGCTTGGTGAG

Full Affymetrix probeset data:

Annotations for 1635595_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720