FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635596_at:

>probe:Drosophila_2:1635596_at:623:495; Interrogation_Position=1224; Antisense; GTCATTCCCAATTACCTAACACTAT
>probe:Drosophila_2:1635596_at:296:673; Interrogation_Position=1236; Antisense; TACCTAACACTATGCGCGGAACCAG
>probe:Drosophila_2:1635596_at:176:349; Interrogation_Position=1282; Antisense; GCAGGTCGGGCTTCGGAGATCCTCA
>probe:Drosophila_2:1635596_at:448:427; Interrogation_Position=1297; Antisense; GAGATCCTCACGACTCAGCGGATGA
>probe:Drosophila_2:1635596_at:670:331; Interrogation_Position=1332; Antisense; GCGGCGGAACCAAAGCGATCACTTA
>probe:Drosophila_2:1635596_at:607:261; Interrogation_Position=1371; Antisense; CAGCGTTTGAGTGGCCAGCTAGCAA
>probe:Drosophila_2:1635596_at:563:109; Interrogation_Position=1399; Antisense; AGCAATCCCTATCCGTTGTAGACGG
>probe:Drosophila_2:1635596_at:78:677; Interrogation_Position=1417; Antisense; TAGACGGAGCACTGACTTCCAAGCG
>probe:Drosophila_2:1635596_at:172:205; Interrogation_Position=1437; Antisense; AAGCGGGCTCCAGCGATTCAACTAC
>probe:Drosophila_2:1635596_at:327:201; Interrogation_Position=1480; Antisense; AACCCGCCTGTAGAGCCCAAATGAG
>probe:Drosophila_2:1635596_at:82:247; Interrogation_Position=1528; Antisense; AATTCCGCATGCTGGATAATTCGGC
>probe:Drosophila_2:1635596_at:292:581; Interrogation_Position=1600; Antisense; TGGCTGCGGGTCTATGCAACCTTAA
>probe:Drosophila_2:1635596_at:39:507; Interrogation_Position=1654; Antisense; GTGCCATCCGCGAAGGTCTGTTTAA
>probe:Drosophila_2:1635596_at:59:581; Interrogation_Position=1680; Antisense; GGCCAACCAGATGTTATTGTCCTAG

Paste this into a BLAST search page for me
GTCATTCCCAATTACCTAACACTATTACCTAACACTATGCGCGGAACCAGGCAGGTCGGGCTTCGGAGATCCTCAGAGATCCTCACGACTCAGCGGATGAGCGGCGGAACCAAAGCGATCACTTACAGCGTTTGAGTGGCCAGCTAGCAAAGCAATCCCTATCCGTTGTAGACGGTAGACGGAGCACTGACTTCCAAGCGAAGCGGGCTCCAGCGATTCAACTACAACCCGCCTGTAGAGCCCAAATGAGAATTCCGCATGCTGGATAATTCGGCTGGCTGCGGGTCTATGCAACCTTAAGTGCCATCCGCGAAGGTCTGTTTAAGGCCAACCAGATGTTATTGTCCTAG

Full Affymetrix probeset data:

Annotations for 1635596_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720