Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635598_at:

>probe:Drosophila_2:1635598_at:626:413; Interrogation_Position=1219; Antisense; GACCTCTAGCTCCAGTTTGGGATCG
>probe:Drosophila_2:1635598_at:199:729; Interrogation_Position=1235; Antisense; TTGGGATCGGTTTCCAGCTCTAGCA
>probe:Drosophila_2:1635598_at:80:161; Interrogation_Position=1268; Antisense; ACAAGGAAGGTGTCTCCCGAGAACA
>probe:Drosophila_2:1635598_at:411:389; Interrogation_Position=1346; Antisense; GAAAAACAACGCCTGATCCGACTGC
>probe:Drosophila_2:1635598_at:538:227; Interrogation_Position=1416; Antisense; AAGGCGCCTGGCAGAACTGGATGAA
>probe:Drosophila_2:1635598_at:659:237; Interrogation_Position=1475; Antisense; AATCAGGGCTTTGACACGCTGCGCG
>probe:Drosophila_2:1635598_at:44:623; Interrogation_Position=1494; Antisense; TGCGCGGTACCATATCCAACATCTA
>probe:Drosophila_2:1635598_at:482:189; Interrogation_Position=1511; Antisense; AACATCTACATCAATCCCGTGCAAT
>probe:Drosophila_2:1635598_at:203:65; Interrogation_Position=1534; Antisense; ATGGGTGTCCAATATCGATCCGCAG
>probe:Drosophila_2:1635598_at:587:521; Interrogation_Position=1565; Antisense; GGGCGCAGTCGTTAGAATTCCTTGG
>probe:Drosophila_2:1635598_at:118:587; Interrogation_Position=1587; Antisense; TGGAGCGCTCTCACATTCGTTAGTC
>probe:Drosophila_2:1635598_at:703:677; Interrogation_Position=1607; Antisense; TAGTCCATCGCCATTTCACGCTGAA
>probe:Drosophila_2:1635598_at:455:333; Interrogation_Position=1692; Antisense; GCTGGGCCCGCAAAATGATTTTAAT
>probe:Drosophila_2:1635598_at:647:585; Interrogation_Position=1758; Antisense; TGGATCCCACTTTGTTTTACCTTCG

Paste this into a BLAST search page for me
GACCTCTAGCTCCAGTTTGGGATCGTTGGGATCGGTTTCCAGCTCTAGCAACAAGGAAGGTGTCTCCCGAGAACAGAAAAACAACGCCTGATCCGACTGCAAGGCGCCTGGCAGAACTGGATGAAAATCAGGGCTTTGACACGCTGCGCGTGCGCGGTACCATATCCAACATCTAAACATCTACATCAATCCCGTGCAATATGGGTGTCCAATATCGATCCGCAGGGGCGCAGTCGTTAGAATTCCTTGGTGGAGCGCTCTCACATTCGTTAGTCTAGTCCATCGCCATTTCACGCTGAAGCTGGGCCCGCAAAATGATTTTAATTGGATCCCACTTTGTTTTACCTTCG

Full Affymetrix probeset data:

Annotations for 1635598_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime