FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635599_at:

>probe:Drosophila_2:1635599_at:399:711; Interrogation_Position=1020; Antisense; TTCAAGCCGCAGTTACAAGTCATCT
>probe:Drosophila_2:1635599_at:303:33; Interrogation_Position=1074; Antisense; ATCAATTGCTTTTACAGCCGGCTCT
>probe:Drosophila_2:1635599_at:659:719; Interrogation_Position=1103; Antisense; TTCCCATTTCTACTGGCTCGAATAT
>probe:Drosophila_2:1635599_at:426:715; Interrogation_Position=1149; Antisense; TTCGGTGGTTACTTTTGTCAATCAA
>probe:Drosophila_2:1635599_at:658:425; Interrogation_Position=651; Antisense; GAGAGTTCACCTCAAACTTTTGCGA
>probe:Drosophila_2:1635599_at:354:425; Interrogation_Position=685; Antisense; GAGAGCCTGTGCACAGATTCTGGAA
>probe:Drosophila_2:1635599_at:255:475; Interrogation_Position=799; Antisense; GTTACCCGCACAATTTTCGTTCAAT
>probe:Drosophila_2:1635599_at:528:695; Interrogation_Position=813; Antisense; TTTCGTTCAATTCCTCTTGATCGGA
>probe:Drosophila_2:1635599_at:497:19; Interrogation_Position=838; Antisense; ATTTGCCTTGGCCTTTCAATGATCA
>probe:Drosophila_2:1635599_at:596:713; Interrogation_Position=871; Antisense; TTCTTTGCCGACATCTGGACAGGAT
>probe:Drosophila_2:1635599_at:524:579; Interrogation_Position=897; Antisense; GGCCACAGTGGCTTACATCAATGGT
>probe:Drosophila_2:1635599_at:204:105; Interrogation_Position=932; Antisense; AGACATTTCCATTTTGCTTCGTTTG
>probe:Drosophila_2:1635599_at:634:3; Interrogation_Position=974; Antisense; ATTGTGAACTTCTTGTGTCGGCCAT
>probe:Drosophila_2:1635599_at:599:597; Interrogation_Position=989; Antisense; TGTCGGCCATATTTCATTCCAACTG

Paste this into a BLAST search page for me
TTCAAGCCGCAGTTACAAGTCATCTATCAATTGCTTTTACAGCCGGCTCTTTCCCATTTCTACTGGCTCGAATATTTCGGTGGTTACTTTTGTCAATCAAGAGAGTTCACCTCAAACTTTTGCGAGAGAGCCTGTGCACAGATTCTGGAAGTTACCCGCACAATTTTCGTTCAATTTTCGTTCAATTCCTCTTGATCGGAATTTGCCTTGGCCTTTCAATGATCATTCTTTGCCGACATCTGGACAGGATGGCCACAGTGGCTTACATCAATGGTAGACATTTCCATTTTGCTTCGTTTGATTGTGAACTTCTTGTGTCGGCCATTGTCGGCCATATTTCATTCCAACTG

Full Affymetrix probeset data:

Annotations for 1635599_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720