Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635601_at:

>probe:Drosophila_2:1635601_at:421:443; Interrogation_Position=114; Antisense; GATGATCATCTCTGGTACGGAAAGT
>probe:Drosophila_2:1635601_at:105:387; Interrogation_Position=150; Antisense; GAAAATTGGTATCGCCCGTATGTAC
>probe:Drosophila_2:1635601_at:397:609; Interrogation_Position=186; Antisense; TGACTTGGTTCAGGCAATTTTCGAA
>probe:Drosophila_2:1635601_at:240:673; Interrogation_Position=236; Antisense; TAGCGTATAAAGTTGGTCGGGACAC
>probe:Drosophila_2:1635601_at:152:399; Interrogation_Position=256; Antisense; GACACGGCCGAGGTGATCAATGACA
>probe:Drosophila_2:1635601_at:283:715; Interrogation_Position=328; Antisense; TTCTACTACAGCAATCACCAGTTCT
>probe:Drosophila_2:1635601_at:173:311; Interrogation_Position=377; Antisense; CCAAGTCCCTGGTCACTGTGGAAAA
>probe:Drosophila_2:1635601_at:162:329; Interrogation_Position=415; Antisense; GCGGAAACCCATTTGGAAGGCTTAG
>probe:Drosophila_2:1635601_at:130:263; Interrogation_Position=456; Antisense; CAGAAATGGTAGCTCCTGCCTGGGA
>probe:Drosophila_2:1635601_at:162:275; Interrogation_Position=489; Antisense; CTTGGTGGTGGTTCTGCTTTTAGCA
>probe:Drosophila_2:1635601_at:59:707; Interrogation_Position=508; Antisense; TTAGCAGTGGGCAGCATGTTGGCCT
>probe:Drosophila_2:1635601_at:328:111; Interrogation_Position=56; Antisense; AGAATATGCTCTGGGCTGCAATCAG
>probe:Drosophila_2:1635601_at:76:359; Interrogation_Position=73; Antisense; GCAATCAGCTGCACGAGAGACTACG
>probe:Drosophila_2:1635601_at:283:421; Interrogation_Position=87; Antisense; GAGAGACTACGAAACCCATTACCAC

Paste this into a BLAST search page for me
GATGATCATCTCTGGTACGGAAAGTGAAAATTGGTATCGCCCGTATGTACTGACTTGGTTCAGGCAATTTTCGAATAGCGTATAAAGTTGGTCGGGACACGACACGGCCGAGGTGATCAATGACATTCTACTACAGCAATCACCAGTTCTCCAAGTCCCTGGTCACTGTGGAAAAGCGGAAACCCATTTGGAAGGCTTAGCAGAAATGGTAGCTCCTGCCTGGGACTTGGTGGTGGTTCTGCTTTTAGCATTAGCAGTGGGCAGCATGTTGGCCTAGAATATGCTCTGGGCTGCAATCAGGCAATCAGCTGCACGAGAGACTACGGAGAGACTACGAAACCCATTACCAC

Full Affymetrix probeset data:

Annotations for 1635601_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime