FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635602_at:

>probe:Drosophila_2:1635602_at:544:533; Interrogation_Position=105; Antisense; GGTGTCCACCACTGATCATTTGGGT
>probe:Drosophila_2:1635602_at:61:403; Interrogation_Position=160; Antisense; GACTTCGAATACTCACTACTGGGCG
>probe:Drosophila_2:1635602_at:664:35; Interrogation_Position=197; Antisense; ATCAGCAATGGTTTCGCGTCAGTCT
>probe:Drosophila_2:1635602_at:581:495; Interrogation_Position=214; Antisense; GTCAGTCTTACTCCGAAAACCAACA
>probe:Drosophila_2:1635602_at:475:143; Interrogation_Position=273; Antisense; ACATCCGCCCTTTAATTCGCAAGTG
>probe:Drosophila_2:1635602_at:411:563; Interrogation_Position=28; Antisense; GGAAGAGCCGTACCCACCGATTTGG
>probe:Drosophila_2:1635602_at:3:581; Interrogation_Position=296; Antisense; TGGCCCACCGGCATGATAAAACTAT
>probe:Drosophila_2:1635602_at:118:79; Interrogation_Position=323; Antisense; AGGATCTGCTTAACTGGCTGGACCG
>probe:Drosophila_2:1635602_at:366:581; Interrogation_Position=337; Antisense; TGGCTGGACCGTTCCGAGGATCAGA
>probe:Drosophila_2:1635602_at:343:513; Interrogation_Position=380; Antisense; GTGATCTCTTGGAGTACACACCACA
>probe:Drosophila_2:1635602_at:263:567; Interrogation_Position=405; Antisense; GGCACAGTCATCCAGCCAGGAGTAT
>probe:Drosophila_2:1635602_at:626:125; Interrogation_Position=43; Antisense; ACCGATTTGGCCAGATACTCTCAGT
>probe:Drosophila_2:1635602_at:236:325; Interrogation_Position=454; Antisense; GCGAAGAAGTCGTCCCAGAAGCAGA
>probe:Drosophila_2:1635602_at:381:61; Interrogation_Position=480; Antisense; ATGTCATAGGCGCAATCACCGACTG

Paste this into a BLAST search page for me
GGTGTCCACCACTGATCATTTGGGTGACTTCGAATACTCACTACTGGGCGATCAGCAATGGTTTCGCGTCAGTCTGTCAGTCTTACTCCGAAAACCAACAACATCCGCCCTTTAATTCGCAAGTGGGAAGAGCCGTACCCACCGATTTGGTGGCCCACCGGCATGATAAAACTATAGGATCTGCTTAACTGGCTGGACCGTGGCTGGACCGTTCCGAGGATCAGAGTGATCTCTTGGAGTACACACCACAGGCACAGTCATCCAGCCAGGAGTATACCGATTTGGCCAGATACTCTCAGTGCGAAGAAGTCGTCCCAGAAGCAGAATGTCATAGGCGCAATCACCGACTG

Full Affymetrix probeset data:

Annotations for 1635602_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720