FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635603_at:

>probe:Drosophila_2:1635603_at:268:75; Interrogation_Position=207; Antisense; AGGAGCGGCCCGAGAATCCCATGGA
>probe:Drosophila_2:1635603_at:265:585; Interrogation_Position=228; Antisense; TGGACTACATCCGTAACCACATCGG
>probe:Drosophila_2:1635603_at:656:111; Interrogation_Position=267; Antisense; AGCACGACAAGTACGAGCGCCTGCA
>probe:Drosophila_2:1635603_at:693:641; Interrogation_Position=298; Antisense; TCTGCAGCTGGCCAACGAGGAGATC
>probe:Drosophila_2:1635603_at:214:77; Interrogation_Position=315; Antisense; AGGAGATCCAGCGTCTGCGCGCCAT
>probe:Drosophila_2:1635603_at:311:139; Interrogation_Position=360; Antisense; ACGTGCTCCAGGGTCATCAGCCAGT
>probe:Drosophila_2:1635603_at:98:197; Interrogation_Position=482; Antisense; AACGGCGAGACTGAGCTGGAGAAAC
>probe:Drosophila_2:1635603_at:4:715; Interrogation_Position=517; Antisense; TTCGGCGGACGTTGCGGAGATAACT
>probe:Drosophila_2:1635603_at:129:593; Interrogation_Position=579; Antisense; TGGTGACCACCGATGAAGCCGCACA
>probe:Drosophila_2:1635603_at:590:177; Interrogation_Position=613; Antisense; AACCGTCCAAGCTGAAGCCAGTGGC
>probe:Drosophila_2:1635603_at:600:267; Interrogation_Position=631; Antisense; CAGTGGCTCCAGTGAGTAGATCTCA
>probe:Drosophila_2:1635603_at:266:453; Interrogation_Position=649; Antisense; GATCTCAGATGACAGCAGCACGTGC
>probe:Drosophila_2:1635603_at:583:505; Interrogation_Position=670; Antisense; GTGCCAGCACACACCAAACGTAAAA
>probe:Drosophila_2:1635603_at:295:179; Interrogation_Position=699; Antisense; AAACATCCCATTTAGAACGCATTCA

Paste this into a BLAST search page for me
AGGAGCGGCCCGAGAATCCCATGGATGGACTACATCCGTAACCACATCGGAGCACGACAAGTACGAGCGCCTGCATCTGCAGCTGGCCAACGAGGAGATCAGGAGATCCAGCGTCTGCGCGCCATACGTGCTCCAGGGTCATCAGCCAGTAACGGCGAGACTGAGCTGGAGAAACTTCGGCGGACGTTGCGGAGATAACTTGGTGACCACCGATGAAGCCGCACAAACCGTCCAAGCTGAAGCCAGTGGCCAGTGGCTCCAGTGAGTAGATCTCAGATCTCAGATGACAGCAGCACGTGCGTGCCAGCACACACCAAACGTAAAAAAACATCCCATTTAGAACGCATTCA

Full Affymetrix probeset data:

Annotations for 1635603_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720