FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635605_at:

>probe:Drosophila_2:1635605_at:591:693; Interrogation_Position=1003; Antisense; TTTGAGCCAGCAACAACCGCTGATC
>probe:Drosophila_2:1635605_at:479:107; Interrogation_Position=1054; Antisense; AGAACAACAGTCTTACCTGCAACAA
>probe:Drosophila_2:1635605_at:36:699; Interrogation_Position=1107; Antisense; TTCTAGCACCACTGATTTAACCCCA
>probe:Drosophila_2:1635605_at:641:127; Interrogation_Position=1150; Antisense; ACCAACATACTGTTTCCCAACAACA
>probe:Drosophila_2:1635605_at:463:41; Interrogation_Position=1180; Antisense; ATCGATGATCCACAATTGCTAACCA
>probe:Drosophila_2:1635605_at:595:669; Interrogation_Position=1326; Antisense; TACGAAATTATTGCCCGTCTTTGAT
>probe:Drosophila_2:1635605_at:363:613; Interrogation_Position=776; Antisense; TGAAAATCGATTTGCCCACGTTTGC
>probe:Drosophila_2:1635605_at:425:139; Interrogation_Position=793; Antisense; ACGTTTGCACCACAATCTGGAGCAG
>probe:Drosophila_2:1635605_at:564:185; Interrogation_Position=853; Antisense; AACAATCAAGCATCTTCATCCCCAA
>probe:Drosophila_2:1635605_at:440:265; Interrogation_Position=888; Antisense; CAGTCCCAGTAATCCAACAACAACA
>probe:Drosophila_2:1635605_at:117:279; Interrogation_Position=932; Antisense; CTAGCACCAGTAGTATCTCCAGTAC
>probe:Drosophila_2:1635605_at:532:91; Interrogation_Position=943; Antisense; AGTATCTCCAGTACTACTAGCACGC
>probe:Drosophila_2:1635605_at:447:147; Interrogation_Position=958; Antisense; ACTAGCACGCCAGTGGAGGAGCTGC
>probe:Drosophila_2:1635605_at:304:419; Interrogation_Position=976; Antisense; GAGCTGCTCCAGTTGTTTCCGCGCT

Paste this into a BLAST search page for me
TTTGAGCCAGCAACAACCGCTGATCAGAACAACAGTCTTACCTGCAACAATTCTAGCACCACTGATTTAACCCCAACCAACATACTGTTTCCCAACAACAATCGATGATCCACAATTGCTAACCATACGAAATTATTGCCCGTCTTTGATTGAAAATCGATTTGCCCACGTTTGCACGTTTGCACCACAATCTGGAGCAGAACAATCAAGCATCTTCATCCCCAACAGTCCCAGTAATCCAACAACAACACTAGCACCAGTAGTATCTCCAGTACAGTATCTCCAGTACTACTAGCACGCACTAGCACGCCAGTGGAGGAGCTGCGAGCTGCTCCAGTTGTTTCCGCGCT

Full Affymetrix probeset data:

Annotations for 1635605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720