FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635606_at:

>probe:Drosophila_2:1635606_at:339:629; Interrogation_Position=2456; Antisense; TCCTATTCAGATTCACTGCGGCAGG
>probe:Drosophila_2:1635606_at:383:99; Interrogation_Position=2510; Antisense; AGATGCTATGGTTCGCAGGACGCCA
>probe:Drosophila_2:1635606_at:154:447; Interrogation_Position=2576; Antisense; GATGCAGTCCGCGATGATGGCGCAC
>probe:Drosophila_2:1635606_at:82:157; Interrogation_Position=2623; Antisense; ACACCTTGATTTATCGCCGGCAATG
>probe:Drosophila_2:1635606_at:4:689; Interrogation_Position=2695; Antisense; TATTTTATTTCATCTTTTTCCACGG
>probe:Drosophila_2:1635606_at:245:283; Interrogation_Position=2717; Antisense; CGGATTTTTCGTTTTGACTGCCTGG
>probe:Drosophila_2:1635606_at:220:575; Interrogation_Position=2741; Antisense; GGCGGCACTCTTTATTTATCTTTCA
>probe:Drosophila_2:1635606_at:242:499; Interrogation_Position=2780; Antisense; GTCGCTTTTCTAAAAATTCCCCATG
>probe:Drosophila_2:1635606_at:494:5; Interrogation_Position=2795; Antisense; ATTCCCCATGTTATTTCAACCTGGC
>probe:Drosophila_2:1635606_at:724:149; Interrogation_Position=2874; Antisense; ACATCCAGCAATTCCGTGGTTTGAA
>probe:Drosophila_2:1635606_at:343:539; Interrogation_Position=2891; Antisense; GGTTTGAATTCTTTCGTGCATTGAC
>probe:Drosophila_2:1635606_at:487:509; Interrogation_Position=2906; Antisense; GTGCATTGACTACGAAATACCCTTT
>probe:Drosophila_2:1635606_at:522:493; Interrogation_Position=2957; Antisense; GTAATTCTTTTTTCTGCAATCCAGC
>probe:Drosophila_2:1635606_at:667:233; Interrogation_Position=2973; Antisense; CAATCCAGCTCTAAAACGGGTTTCT

Paste this into a BLAST search page for me
TCCTATTCAGATTCACTGCGGCAGGAGATGCTATGGTTCGCAGGACGCCAGATGCAGTCCGCGATGATGGCGCACACACCTTGATTTATCGCCGGCAATGTATTTTATTTCATCTTTTTCCACGGCGGATTTTTCGTTTTGACTGCCTGGGGCGGCACTCTTTATTTATCTTTCAGTCGCTTTTCTAAAAATTCCCCATGATTCCCCATGTTATTTCAACCTGGCACATCCAGCAATTCCGTGGTTTGAAGGTTTGAATTCTTTCGTGCATTGACGTGCATTGACTACGAAATACCCTTTGTAATTCTTTTTTCTGCAATCCAGCCAATCCAGCTCTAAAACGGGTTTCT

Full Affymetrix probeset data:

Annotations for 1635606_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720