Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635607_at:

>probe:Drosophila_2:1635607_at:560:519; Interrogation_Position=271; Antisense; GTGGATTCCAGAGCCACGTCGGGAA
>probe:Drosophila_2:1635607_at:176:5; Interrogation_Position=377; Antisense; ATTGCACATACTGGGATCGAGCTTT
>probe:Drosophila_2:1635607_at:715:417; Interrogation_Position=395; Antisense; GAGCTTTGACCAGGGAGTGCCGACT
>probe:Drosophila_2:1635607_at:45:407; Interrogation_Position=416; Antisense; GACTGCACGAGCTCCGCTATAAGGA
>probe:Drosophila_2:1635607_at:521:657; Interrogation_Position=435; Antisense; TAAGGAGCGACTTCCAGTCCAATCT
>probe:Drosophila_2:1635607_at:15:23; Interrogation_Position=468; Antisense; ATATATCTCCAACGTGGCTGCGGAA
>probe:Drosophila_2:1635607_at:196:555; Interrogation_Position=547; Antisense; GGACCCAGTTTGGTATACGTGGACT
>probe:Drosophila_2:1635607_at:27:197; Interrogation_Position=574; Antisense; AACGGCCTGCGGATCCATGGAAAGC
>probe:Drosophila_2:1635607_at:333:65; Interrogation_Position=590; Antisense; ATGGAAAGCTTTTCGCCGTGGGCAG
>probe:Drosophila_2:1635607_at:420:233; Interrogation_Position=625; Antisense; AATGCCCTGGGAATTTTGGACTCTG
>probe:Drosophila_2:1635607_at:343:241; Interrogation_Position=636; Antisense; AATTTTGGACTCTGACTACCGGTTG
>probe:Drosophila_2:1635607_at:642:403; Interrogation_Position=649; Antisense; GACTACCGGTTGGATCTCAGTGATA
>probe:Drosophila_2:1635607_at:532:581; Interrogation_Position=689; Antisense; TGGCCTTCCTTGCAGTATATCATGC
>probe:Drosophila_2:1635607_at:493:265; Interrogation_Position=722; Antisense; CAGATATCTTTTCAGGCGGTGTGGT

Paste this into a BLAST search page for me
GTGGATTCCAGAGCCACGTCGGGAAATTGCACATACTGGGATCGAGCTTTGAGCTTTGACCAGGGAGTGCCGACTGACTGCACGAGCTCCGCTATAAGGATAAGGAGCGACTTCCAGTCCAATCTATATATCTCCAACGTGGCTGCGGAAGGACCCAGTTTGGTATACGTGGACTAACGGCCTGCGGATCCATGGAAAGCATGGAAAGCTTTTCGCCGTGGGCAGAATGCCCTGGGAATTTTGGACTCTGAATTTTGGACTCTGACTACCGGTTGGACTACCGGTTGGATCTCAGTGATATGGCCTTCCTTGCAGTATATCATGCCAGATATCTTTTCAGGCGGTGTGGT

Full Affymetrix probeset data:

Annotations for 1635607_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime