FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635608_at:

>probe:Drosophila_2:1635608_at:87:173; Interrogation_Position=1020; Antisense; AAAGCTAAGCCGGACTTCCTGTACG
>probe:Drosophila_2:1635608_at:369:323; Interrogation_Position=1044; Antisense; GCGCCCCTTCATATTTGCAGTATGA
>probe:Drosophila_2:1635608_at:269:511; Interrogation_Position=517; Antisense; GTGACATTCAAGCTGATCAAGGGCA
>probe:Drosophila_2:1635608_at:229:151; Interrogation_Position=554; Antisense; ACATCCACGGGCACAACATCAAGGA
>probe:Drosophila_2:1635608_at:160:421; Interrogation_Position=646; Antisense; GAGCACCCAAAGAAGCGCGCCAAGA
>probe:Drosophila_2:1635608_at:325:377; Interrogation_Position=675; Antisense; GAACGCCGCCGATGGTAAAAATGCC
>probe:Drosophila_2:1635608_at:292:373; Interrogation_Position=714; Antisense; GAAGTAAACTGCTGACCGCCAATCA
>probe:Drosophila_2:1635608_at:635:237; Interrogation_Position=734; Antisense; AATCATCCATCGAGGTTTAAGCTAT
>probe:Drosophila_2:1635608_at:139:39; Interrogation_Position=829; Antisense; ATCTAGTTCCTTTTGAACAGCTCCT
>probe:Drosophila_2:1635608_at:37:189; Interrogation_Position=844; Antisense; AACAGCTCCTTTTACATTCAATTCA
>probe:Drosophila_2:1635608_at:259:211; Interrogation_Position=869; Antisense; AAGACAACGTTGTGTGCTCGGTCGT
>probe:Drosophila_2:1635608_at:116:637; Interrogation_Position=890; Antisense; TCGTGTTTCCCCAGCGAATGGTCTG
>probe:Drosophila_2:1635608_at:331:229; Interrogation_Position=906; Antisense; AATGGTCTGTCGCTCAGCCAGGAGT
>probe:Drosophila_2:1635608_at:94:557; Interrogation_Position=957; Antisense; GGACTGTGACTGATCCGGACACTAA

Paste this into a BLAST search page for me
AAAGCTAAGCCGGACTTCCTGTACGGCGCCCCTTCATATTTGCAGTATGAGTGACATTCAAGCTGATCAAGGGCAACATCCACGGGCACAACATCAAGGAGAGCACCCAAAGAAGCGCGCCAAGAGAACGCCGCCGATGGTAAAAATGCCGAAGTAAACTGCTGACCGCCAATCAAATCATCCATCGAGGTTTAAGCTATATCTAGTTCCTTTTGAACAGCTCCTAACAGCTCCTTTTACATTCAATTCAAAGACAACGTTGTGTGCTCGGTCGTTCGTGTTTCCCCAGCGAATGGTCTGAATGGTCTGTCGCTCAGCCAGGAGTGGACTGTGACTGATCCGGACACTAA

Full Affymetrix probeset data:

Annotations for 1635608_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720