FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635610_at:

>probe:Drosophila_2:1635610_at:683:1; Interrogation_Position=217; Antisense; TTGGCCGAGGTCAAGTTTACGACCG
>probe:Drosophila_2:1635610_at:502:671; Interrogation_Position=234; Antisense; TACGACCGGCGACATCAATCAGATT
>probe:Drosophila_2:1635610_at:452:95; Interrogation_Position=254; Antisense; AGATTGTGCTGCAGAACGTGACCAA
>probe:Drosophila_2:1635610_at:516:35; Interrogation_Position=334; Antisense; ATCTTCGAACCCTACACGGATGGCG
>probe:Drosophila_2:1635610_at:524:519; Interrogation_Position=358; Antisense; GTGGACACCTATGAGTTGGCCGGCC
>probe:Drosophila_2:1635610_at:62:211; Interrogation_Position=418; Antisense; AAGAACTACCAGAGCGCCGTGCGCC
>probe:Drosophila_2:1635610_at:82:727; Interrogation_Position=476; Antisense; TTGTTACCCTCGACGATGTCATCAA
>probe:Drosophila_2:1635610_at:575:61; Interrogation_Position=491; Antisense; ATGTCATCAAGGTCACCAACCGGCG
>probe:Drosophila_2:1635610_at:434:431; Interrogation_Position=515; Antisense; GAGTCAACGCCATCGAGCACGTGAT
>probe:Drosophila_2:1635610_at:101:299; Interrogation_Position=547; Antisense; CGCATCAACCGCACCATAGAGTATA
>probe:Drosophila_2:1635610_at:433:25; Interrogation_Position=562; Antisense; ATAGAGTATATCATCAGCGAGCTGG
>probe:Drosophila_2:1635610_at:474:327; Interrogation_Position=641; Antisense; GCGAGGCTCGCAAGGCATCCGATAA
>probe:Drosophila_2:1635610_at:226:163; Interrogation_Position=664; Antisense; AAATTGCGAGCGGAGCAGCGTCTTC
>probe:Drosophila_2:1635610_at:307:327; Interrogation_Position=681; Antisense; GCGTCTTCTGGGTCAAATGGCCGAA

Paste this into a BLAST search page for me
TTGGCCGAGGTCAAGTTTACGACCGTACGACCGGCGACATCAATCAGATTAGATTGTGCTGCAGAACGTGACCAAATCTTCGAACCCTACACGGATGGCGGTGGACACCTATGAGTTGGCCGGCCAAGAACTACCAGAGCGCCGTGCGCCTTGTTACCCTCGACGATGTCATCAAATGTCATCAAGGTCACCAACCGGCGGAGTCAACGCCATCGAGCACGTGATCGCATCAACCGCACCATAGAGTATAATAGAGTATATCATCAGCGAGCTGGGCGAGGCTCGCAAGGCATCCGATAAAAATTGCGAGCGGAGCAGCGTCTTCGCGTCTTCTGGGTCAAATGGCCGAA

Full Affymetrix probeset data:

Annotations for 1635610_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720