FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635613_at:

>probe:Drosophila_2:1635613_at:540:617; Interrogation_Position=107; Antisense; TCGTCCAACAGTGCCGAGAGCTCGG
>probe:Drosophila_2:1635613_at:674:49; Interrogation_Position=13; Antisense; ATGCCTGGCCTGAAGGAGCAGCCCC
>probe:Drosophila_2:1635613_at:341:85; Interrogation_Position=143; Antisense; AGTGCGGCGCCCAGTTACCAGCAGC
>probe:Drosophila_2:1635613_at:84:633; Interrogation_Position=197; Antisense; TCCGCCAGCAGTTGGCAGCTTAGTA
>probe:Drosophila_2:1635613_at:505:493; Interrogation_Position=219; Antisense; GTAATGCAGCATTCAAGTCGCGCCT
>probe:Drosophila_2:1635613_at:392:553; Interrogation_Position=27; Antisense; GGAGCAGCCCCATCCGATGCGTAGA
>probe:Drosophila_2:1635613_at:391:137; Interrogation_Position=357; Antisense; ACGAGGGCGCATCTCATCAGGAAGT
>probe:Drosophila_2:1635613_at:116:527; Interrogation_Position=413; Antisense; GGGCAAAAGACCAAACTTCAGACAG
>probe:Drosophila_2:1635613_at:25:447; Interrogation_Position=42; Antisense; GATGCGTAGACTCATTAGACAGCTA
>probe:Drosophila_2:1635613_at:301:165; Interrogation_Position=453; Antisense; AAATCAGTCCCAAGAGTGAGAGTAA
>probe:Drosophila_2:1635613_at:480:243; Interrogation_Position=478; Antisense; AATATTCAAAGCTTTCACCTCCTGC
>probe:Drosophila_2:1635613_at:107:629; Interrogation_Position=497; Antisense; TCCTGCAAGTGCACCCAAAAGTAGG
>probe:Drosophila_2:1635613_at:459:399; Interrogation_Position=59; Antisense; GACAGCTATCAAACCATGTTCTGGA
>probe:Drosophila_2:1635613_at:292:203; Interrogation_Position=70; Antisense; AACCATGTTCTGGACGGCGGTAGCC

Paste this into a BLAST search page for me
TCGTCCAACAGTGCCGAGAGCTCGGATGCCTGGCCTGAAGGAGCAGCCCCAGTGCGGCGCCCAGTTACCAGCAGCTCCGCCAGCAGTTGGCAGCTTAGTAGTAATGCAGCATTCAAGTCGCGCCTGGAGCAGCCCCATCCGATGCGTAGAACGAGGGCGCATCTCATCAGGAAGTGGGCAAAAGACCAAACTTCAGACAGGATGCGTAGACTCATTAGACAGCTAAAATCAGTCCCAAGAGTGAGAGTAAAATATTCAAAGCTTTCACCTCCTGCTCCTGCAAGTGCACCCAAAAGTAGGGACAGCTATCAAACCATGTTCTGGAAACCATGTTCTGGACGGCGGTAGCC

Full Affymetrix probeset data:

Annotations for 1635613_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720