FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635621_at:

>probe:Drosophila_2:1635621_at:99:323; Interrogation_Position=137; Antisense; GCGCCTCGAACATCCGCGGAATGAA
>probe:Drosophila_2:1635621_at:187:233; Interrogation_Position=156; Antisense; AATGAACGCCGGGTGGCCTTTCACG
>probe:Drosophila_2:1635621_at:163:697; Interrogation_Position=174; Antisense; TTTCACGCTGGGATCATCGACAACG
>probe:Drosophila_2:1635621_at:331:253; Interrogation_Position=212; Antisense; CAAGAAGTCCAAATGCTGCTGCATT
>probe:Drosophila_2:1635621_at:326:665; Interrogation_Position=237; Antisense; TACAAAAAACCTCTCGCGTTCGGCG
>probe:Drosophila_2:1635621_at:404:445; Interrogation_Position=276; Antisense; GATGACGAAGACTGTGAGCACTGCT
>probe:Drosophila_2:1635621_at:104:609; Interrogation_Position=290; Antisense; TGAGCACTGCTTTGGACATCCGGAA
>probe:Drosophila_2:1635621_at:499:159; Interrogation_Position=355; Antisense; ACAAACCATGCACGGAGGCGTCGCA
>probe:Drosophila_2:1635621_at:368:563; Interrogation_Position=383; Antisense; GGAAGGACCTTCGACATCAACGCAG
>probe:Drosophila_2:1635621_at:323:279; Interrogation_Position=469; Antisense; CTACCCCAGGTGTTGACTTTGAGCA
>probe:Drosophila_2:1635621_at:403:401; Interrogation_Position=47; Antisense; GACATCCAATGGCTCGACAACTGAA
>probe:Drosophila_2:1635621_at:389:563; Interrogation_Position=544; Antisense; GGAACCAACTAGCAAGCACTCAGAT
>probe:Drosophila_2:1635621_at:296:175; Interrogation_Position=82; Antisense; AAACCGATGCCCGTGCTCAATTGGA
>probe:Drosophila_2:1635621_at:53:619; Interrogation_Position=95; Antisense; TGCTCAATTGGAATCGGGCCGGACC

Paste this into a BLAST search page for me
GCGCCTCGAACATCCGCGGAATGAAAATGAACGCCGGGTGGCCTTTCACGTTTCACGCTGGGATCATCGACAACGCAAGAAGTCCAAATGCTGCTGCATTTACAAAAAACCTCTCGCGTTCGGCGGATGACGAAGACTGTGAGCACTGCTTGAGCACTGCTTTGGACATCCGGAAACAAACCATGCACGGAGGCGTCGCAGGAAGGACCTTCGACATCAACGCAGCTACCCCAGGTGTTGACTTTGAGCAGACATCCAATGGCTCGACAACTGAAGGAACCAACTAGCAAGCACTCAGATAAACCGATGCCCGTGCTCAATTGGATGCTCAATTGGAATCGGGCCGGACC

Full Affymetrix probeset data:

Annotations for 1635621_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720