FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635623_at:

>probe:Drosophila_2:1635623_at:497:519; Interrogation_Position=1123; Antisense; GTGGAGTAAGTGTCTCCTCTGAGCG
>probe:Drosophila_2:1635623_at:554:525; Interrogation_Position=1288; Antisense; GGGACAATTACCACCTCAACGATGA
>probe:Drosophila_2:1635623_at:76:301; Interrogation_Position=1346; Antisense; CGCCAACCACCGAATTCTAGAGATC
>probe:Drosophila_2:1635623_at:180:487; Interrogation_Position=1429; Antisense; GTAAATGGTACGTGGGCCTGCCGCC
>probe:Drosophila_2:1635623_at:318:317; Interrogation_Position=1451; Antisense; GCCTGGTCAAAGTGTGCGTGCCCAT
>probe:Drosophila_2:1635623_at:407:623; Interrogation_Position=1465; Antisense; TGCGTGCCCATGTCCAGAACATCGA
>probe:Drosophila_2:1635623_at:641:149; Interrogation_Position=1483; Antisense; ACATCGACATAATACCCTTGGGCGG
>probe:Drosophila_2:1635623_at:607:369; Interrogation_Position=1507; Antisense; GAAGGATCGGACTTTCGCCGTCGGA
>probe:Drosophila_2:1635623_at:93:259; Interrogation_Position=1534; Antisense; CACTGCGTCAGGATGAGATCGCCGA
>probe:Drosophila_2:1635623_at:218:419; Interrogation_Position=1557; Antisense; GAGCTGAATGCCTCAAGGGAGCACT
>probe:Drosophila_2:1635623_at:72:421; Interrogation_Position=1575; Antisense; GAGCACTAAGCACCCATTGGATCTG
>probe:Drosophila_2:1635623_at:83:39; Interrogation_Position=1603; Antisense; ATCTGTAGTTTGTAGTGCGTAGCTC
>probe:Drosophila_2:1635623_at:555:623; Interrogation_Position=1618; Antisense; TGCGTAGCTCTAAGTGATCAGTGTT
>probe:Drosophila_2:1635623_at:403:391; Interrogation_Position=1651; Antisense; GAAACTGGGTTGACTCCACATGGAA

Paste this into a BLAST search page for me
GTGGAGTAAGTGTCTCCTCTGAGCGGGGACAATTACCACCTCAACGATGACGCCAACCACCGAATTCTAGAGATCGTAAATGGTACGTGGGCCTGCCGCCGCCTGGTCAAAGTGTGCGTGCCCATTGCGTGCCCATGTCCAGAACATCGAACATCGACATAATACCCTTGGGCGGGAAGGATCGGACTTTCGCCGTCGGACACTGCGTCAGGATGAGATCGCCGAGAGCTGAATGCCTCAAGGGAGCACTGAGCACTAAGCACCCATTGGATCTGATCTGTAGTTTGTAGTGCGTAGCTCTGCGTAGCTCTAAGTGATCAGTGTTGAAACTGGGTTGACTCCACATGGAA

Full Affymetrix probeset data:

Annotations for 1635623_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720