Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635628_s_at:

>probe:Drosophila_2:1635628_s_at:437:37; Interrogation_Position=1028; Antisense; ATCTTCGCCTATTTTCCTGTTGAAT
>probe:Drosophila_2:1635628_s_at:12:313; Interrogation_Position=1069; Antisense; GCCAGCTACATATGCAATCATTTAA
>probe:Drosophila_2:1635628_s_at:720:45; Interrogation_Position=1135; Antisense; ATCCAACATTTTTACGAACCTCTAT
>probe:Drosophila_2:1635628_s_at:656:379; Interrogation_Position=1150; Antisense; GAACCTCTATGTGTGTATCGCCTAC
>probe:Drosophila_2:1635628_s_at:722:679; Interrogation_Position=1165; Antisense; TATCGCCTACGACCTTTGAATTTAA
>probe:Drosophila_2:1635628_s_at:729:317; Interrogation_Position=738; Antisense; GCCGGATTCTTCTCGCAGATCGGAA
>probe:Drosophila_2:1635628_s_at:576:375; Interrogation_Position=760; Antisense; GAAGACTGTACAATGTTCATCACAT
>probe:Drosophila_2:1635628_s_at:60:725; Interrogation_Position=785; Antisense; TTGGTGTTACAAATCTCTGCAAGAC
>probe:Drosophila_2:1635628_s_at:259:279; Interrogation_Position=799; Antisense; CTCTGCAAGACCGTAAGGAGACCCG
>probe:Drosophila_2:1635628_s_at:578:665; Interrogation_Position=867; Antisense; TACACGGTGCCATTAATCCGCGAGA
>probe:Drosophila_2:1635628_s_at:621:655; Interrogation_Position=880; Antisense; TAATCCGCGAGATGCACTGCCGTGT
>probe:Drosophila_2:1635628_s_at:473:429; Interrogation_Position=918; Antisense; GAGTTCTCGCCCTCACAATAATTAG
>probe:Drosophila_2:1635628_s_at:710:13; Interrogation_Position=938; Antisense; ATTAGCACTGGGTGTTGCACTTTCT
>probe:Drosophila_2:1635628_s_at:372:603; Interrogation_Position=950; Antisense; TGTTGCACTTTCTAGCGTTCTGAGA

Paste this into a BLAST search page for me
ATCTTCGCCTATTTTCCTGTTGAATGCCAGCTACATATGCAATCATTTAAATCCAACATTTTTACGAACCTCTATGAACCTCTATGTGTGTATCGCCTACTATCGCCTACGACCTTTGAATTTAAGCCGGATTCTTCTCGCAGATCGGAAGAAGACTGTACAATGTTCATCACATTTGGTGTTACAAATCTCTGCAAGACCTCTGCAAGACCGTAAGGAGACCCGTACACGGTGCCATTAATCCGCGAGATAATCCGCGAGATGCACTGCCGTGTGAGTTCTCGCCCTCACAATAATTAGATTAGCACTGGGTGTTGCACTTTCTTGTTGCACTTTCTAGCGTTCTGAGA

Full Affymetrix probeset data:

Annotations for 1635628_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime