FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635629_at:

>probe:Drosophila_2:1635629_at:60:201; Interrogation_Position=103; Antisense; AACGCCAACAAGACCGAGTGGATTG
>probe:Drosophila_2:1635629_at:725:429; Interrogation_Position=118; Antisense; GAGTGGATTGATTCGGAACCCGATG
>probe:Drosophila_2:1635629_at:247:133; Interrogation_Position=135; Antisense; ACCCGATGATCGTGTTTTGGCCAGA
>probe:Drosophila_2:1635629_at:500:439; Interrogation_Position=172; Antisense; GATGTGGCCGAAACATTTCGTCGGA
>probe:Drosophila_2:1635629_at:28:663; Interrogation_Position=269; Antisense; TAAAAGACTCGCCTGTCCTATACGT
>probe:Drosophila_2:1635629_at:686:351; Interrogation_Position=28; Antisense; GCAGCCGATGAGTCCTTTCTTAAAG
>probe:Drosophila_2:1635629_at:432:503; Interrogation_Position=283; Antisense; GTCCTATACGTAAATCGAGCCCTTT
>probe:Drosophila_2:1635629_at:694:413; Interrogation_Position=299; Antisense; GAGCCCTTTGCTTTATCAAGTTACG
>probe:Drosophila_2:1635629_at:151:191; Interrogation_Position=377; Antisense; AACATTATCTGCGTGCTTGGCTTTA
>probe:Drosophila_2:1635629_at:425:343; Interrogation_Position=391; Antisense; GCTTGGCTTTATAGGGCAGCTGCCT
>probe:Drosophila_2:1635629_at:590:567; Interrogation_Position=405; Antisense; GGCAGCTGCCTATAAGCGTCTGAAT
>probe:Drosophila_2:1635629_at:97:243; Interrogation_Position=446; Antisense; AATATAGTGTTGATCGCGCCAGACG
>probe:Drosophila_2:1635629_at:228:631; Interrogation_Position=506; Antisense; TCCTGGACAAAATGAGATCGCTTCT
>probe:Drosophila_2:1635629_at:442:451; Interrogation_Position=78; Antisense; GATCGAGTACCTGGATGTGCTTGAA

Paste this into a BLAST search page for me
AACGCCAACAAGACCGAGTGGATTGGAGTGGATTGATTCGGAACCCGATGACCCGATGATCGTGTTTTGGCCAGAGATGTGGCCGAAACATTTCGTCGGATAAAAGACTCGCCTGTCCTATACGTGCAGCCGATGAGTCCTTTCTTAAAGGTCCTATACGTAAATCGAGCCCTTTGAGCCCTTTGCTTTATCAAGTTACGAACATTATCTGCGTGCTTGGCTTTAGCTTGGCTTTATAGGGCAGCTGCCTGGCAGCTGCCTATAAGCGTCTGAATAATATAGTGTTGATCGCGCCAGACGTCCTGGACAAAATGAGATCGCTTCTGATCGAGTACCTGGATGTGCTTGAA

Full Affymetrix probeset data:

Annotations for 1635629_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720