FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635632_at:

>probe:Drosophila_2:1635632_at:5:331; Interrogation_Position=374; Antisense; GCGGTTCTGCGTTTGGTATACCAAC
>probe:Drosophila_2:1635632_at:316:439; Interrogation_Position=475; Antisense; GATGGACTCATTCGAATTCCCAAGG
>probe:Drosophila_2:1635632_at:387:545; Interrogation_Position=529; Antisense; GGATCGGTAGCGGTCTTCAAATCAT
>probe:Drosophila_2:1635632_at:411:353; Interrogation_Position=566; Antisense; GCAGCCAGATAGCTTTCTACGATAT
>probe:Drosophila_2:1635632_at:156:287; Interrogation_Position=620; Antisense; CTGTGAATGACGGATTGCCCTTGCA
>probe:Drosophila_2:1635632_at:274:539; Interrogation_Position=661; Antisense; GGTACATCGATCATTTCGTCTGCGA
>probe:Drosophila_2:1635632_at:388:145; Interrogation_Position=688; Antisense; ACTCATCCCCTGGACGTGGTAAGGA
>probe:Drosophila_2:1635632_at:340:703; Interrogation_Position=716; Antisense; TTATGATGAACTCCAGACCCGGCGA
>probe:Drosophila_2:1635632_at:386:575; Interrogation_Position=736; Antisense; GGCGAATTTCGCACAGTCTTCCAAG
>probe:Drosophila_2:1635632_at:451:645; Interrogation_Position=752; Antisense; TCTTCCAAGCGTCTGTTCACATGAT
>probe:Drosophila_2:1635632_at:127:625; Interrogation_Position=776; Antisense; TGCGCTTTGGCGTAATGGGACCCTA
>probe:Drosophila_2:1635632_at:445:411; Interrogation_Position=794; Antisense; GACCCTATCGAGGATTTGTGCCAAC
>probe:Drosophila_2:1635632_at:423:577; Interrogation_Position=837; Antisense; GGCCACCACTTTGCTATTTGTTTTG
>probe:Drosophila_2:1635632_at:696:359; Interrogation_Position=867; Antisense; GCAACTGAGGCTCCATTTCGGAATT

Paste this into a BLAST search page for me
GCGGTTCTGCGTTTGGTATACCAACGATGGACTCATTCGAATTCCCAAGGGGATCGGTAGCGGTCTTCAAATCATGCAGCCAGATAGCTTTCTACGATATCTGTGAATGACGGATTGCCCTTGCAGGTACATCGATCATTTCGTCTGCGAACTCATCCCCTGGACGTGGTAAGGATTATGATGAACTCCAGACCCGGCGAGGCGAATTTCGCACAGTCTTCCAAGTCTTCCAAGCGTCTGTTCACATGATTGCGCTTTGGCGTAATGGGACCCTAGACCCTATCGAGGATTTGTGCCAACGGCCACCACTTTGCTATTTGTTTTGGCAACTGAGGCTCCATTTCGGAATT

Full Affymetrix probeset data:

Annotations for 1635632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720