Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635634_at:

>probe:Drosophila_2:1635634_at:5:443; Interrogation_Position=179; Antisense; GATGTGGAACCAACATATCCCCAGA
>probe:Drosophila_2:1635634_at:685:405; Interrogation_Position=202; Antisense; GACGGTGGACAGATCCGGCCTGCAA
>probe:Drosophila_2:1635634_at:215:231; Interrogation_Position=239; Antisense; AATGTGCTCCTTAACAAATTGCCAT
>probe:Drosophila_2:1635634_at:211:257; Interrogation_Position=253; Antisense; CAAATTGCCATACCAGGAACCTCAC
>probe:Drosophila_2:1635634_at:653:379; Interrogation_Position=269; Antisense; GAACCTCACTCCTGGATTCATTTGA
>probe:Drosophila_2:1635634_at:729:89; Interrogation_Position=300; Antisense; AGTACCAGAGACAGGCATTCGGCCG
>probe:Drosophila_2:1635634_at:336:63; Interrogation_Position=342; Antisense; ATGTGAATCCCAAGATTTGCTTCGA
>probe:Drosophila_2:1635634_at:575:693; Interrogation_Position=357; Antisense; TTTGCTTCGATTCCCACGGAGAGAA
>probe:Drosophila_2:1635634_at:543:475; Interrogation_Position=395; Antisense; GTTATGCAACTAGAAACACTCCTGA
>probe:Drosophila_2:1635634_at:291:321; Interrogation_Position=473; Antisense; GCCCGTGAAGAGGACATTGCGAAGA
>probe:Drosophila_2:1635634_at:144:371; Interrogation_Position=520; Antisense; GAAGGCGGACCTGCACGCGAAGATC
>probe:Drosophila_2:1635634_at:410:617; Interrogation_Position=562; Antisense; TGCAGCGGCAGCCATACAACGCAAG
>probe:Drosophila_2:1635634_at:626:291; Interrogation_Position=610; Antisense; CCGACACTTCGGGTTCAAGGTGGAT
>probe:Drosophila_2:1635634_at:426:519; Interrogation_Position=629; Antisense; GTGGATACACGCGACGAACGCTTTA

Paste this into a BLAST search page for me
GATGTGGAACCAACATATCCCCAGAGACGGTGGACAGATCCGGCCTGCAAAATGTGCTCCTTAACAAATTGCCATCAAATTGCCATACCAGGAACCTCACGAACCTCACTCCTGGATTCATTTGAAGTACCAGAGACAGGCATTCGGCCGATGTGAATCCCAAGATTTGCTTCGATTTGCTTCGATTCCCACGGAGAGAAGTTATGCAACTAGAAACACTCCTGAGCCCGTGAAGAGGACATTGCGAAGAGAAGGCGGACCTGCACGCGAAGATCTGCAGCGGCAGCCATACAACGCAAGCCGACACTTCGGGTTCAAGGTGGATGTGGATACACGCGACGAACGCTTTA

Full Affymetrix probeset data:

Annotations for 1635634_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime