FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635636_at:

>probe:Drosophila_2:1635636_at:53:661; Interrogation_Position=466; Antisense; TAACGTCAGGGCAATCGTCAGCTTC
>probe:Drosophila_2:1635636_at:223:117; Interrogation_Position=485; Antisense; AGCTTCTCGGGCAAACCGCTGGTGA
>probe:Drosophila_2:1635636_at:672:247; Interrogation_Position=523; Antisense; CTACCTGGACGTTACCGATCTGAAA
>probe:Drosophila_2:1635636_at:385:445; Interrogation_Position=553; Antisense; GATGAAGCCGGAGTCCAGCCACTAC
>probe:Drosophila_2:1635636_at:314:251; Interrogation_Position=604; Antisense; CAAGGCGCTGGGTGACAACATGAAT
>probe:Drosophila_2:1635636_at:442:229; Interrogation_Position=626; Antisense; AATGTCTTCCTCAACGAAAACTCGG
>probe:Drosophila_2:1635636_at:327:209; Interrogation_Position=675; Antisense; AAGCAATCGACCGATCCTTTGGCAA
>probe:Drosophila_2:1635636_at:584:689; Interrogation_Position=692; Antisense; TTTGGCAAACTTTACCTGGGCGTCG
>probe:Drosophila_2:1635636_at:300:287; Interrogation_Position=707; Antisense; CTGGGCGTCGTCAAAGGTGTGTTCT
>probe:Drosophila_2:1635636_at:464:81; Interrogation_Position=721; Antisense; AGGTGTGTTCTCCAAACTGCCGTAT
>probe:Drosophila_2:1635636_at:323:145; Interrogation_Position=736; Antisense; ACTGCCGTATGCCAAGTTTTTTGCG
>probe:Drosophila_2:1635636_at:128:417; Interrogation_Position=771; Antisense; GAGTTAGCTCTTCAAAGTGGGCAGA
>probe:Drosophila_2:1635636_at:50:455; Interrogation_Position=814; Antisense; GATCATGTTGTTTGCGTACTGACAG
>probe:Drosophila_2:1635636_at:623:223; Interrogation_Position=875; Antisense; AATGGAGTTCGTGTTTCGCGTTTGA

Paste this into a BLAST search page for me
TAACGTCAGGGCAATCGTCAGCTTCAGCTTCTCGGGCAAACCGCTGGTGACTACCTGGACGTTACCGATCTGAAAGATGAAGCCGGAGTCCAGCCACTACCAAGGCGCTGGGTGACAACATGAATAATGTCTTCCTCAACGAAAACTCGGAAGCAATCGACCGATCCTTTGGCAATTTGGCAAACTTTACCTGGGCGTCGCTGGGCGTCGTCAAAGGTGTGTTCTAGGTGTGTTCTCCAAACTGCCGTATACTGCCGTATGCCAAGTTTTTTGCGGAGTTAGCTCTTCAAAGTGGGCAGAGATCATGTTGTTTGCGTACTGACAGAATGGAGTTCGTGTTTCGCGTTTGA

Full Affymetrix probeset data:

Annotations for 1635636_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720