FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635637_at:

>probe:Drosophila_2:1635637_at:548:341; Interrogation_Position=426; Antisense; GCTTTGCGTATGTGCTGGGACTGTC
>probe:Drosophila_2:1635637_at:668:593; Interrogation_Position=441; Antisense; TGGGACTGTCTTTCTGGCAGAGCAT
>probe:Drosophila_2:1635637_at:500:351; Interrogation_Position=457; Antisense; GCAGAGCATCTCGTTCATATTCTAT
>probe:Drosophila_2:1635637_at:160:557; Interrogation_Position=493; Antisense; GGACTGTATTTTCGTGGGCATCATA
>probe:Drosophila_2:1635637_at:62:37; Interrogation_Position=512; Antisense; ATCATAATAGCCTCGTTCTTCTGGG
>probe:Drosophila_2:1635637_at:125:411; Interrogation_Position=541; Antisense; GACGAATCGGTATCTGCGCACAAAT
>probe:Drosophila_2:1635637_at:244:163; Interrogation_Position=562; Antisense; AAATAGCCTGGAGCCGGATATCGAG
>probe:Drosophila_2:1635637_at:608:441; Interrogation_Position=602; Antisense; GATGTCCATCTAAATGCCTTCTTTC
>probe:Drosophila_2:1635637_at:492:285; Interrogation_Position=656; Antisense; CTGTTCTTCTACAACTGGCTGATCA
>probe:Drosophila_2:1635637_at:51:173; Interrogation_Position=684; Antisense; AAACGTGGTTCATCTCGCGATTTCT
>probe:Drosophila_2:1635637_at:128:461; Interrogation_Position=702; Antisense; GATTTCTGGGCAACACCTTTTGGTT
>probe:Drosophila_2:1635637_at:257:31; Interrogation_Position=766; Antisense; ATACAATTGCATTCCCCATCTGAAA
>probe:Drosophila_2:1635637_at:361:37; Interrogation_Position=824; Antisense; ATCTTTCTACTGTTTCTGGTCGTCA
>probe:Drosophila_2:1635637_at:405:561; Interrogation_Position=861; Antisense; GGAACGCAACGATATCCTTTGTCAA

Paste this into a BLAST search page for me
GCTTTGCGTATGTGCTGGGACTGTCTGGGACTGTCTTTCTGGCAGAGCATGCAGAGCATCTCGTTCATATTCTATGGACTGTATTTTCGTGGGCATCATAATCATAATAGCCTCGTTCTTCTGGGGACGAATCGGTATCTGCGCACAAATAAATAGCCTGGAGCCGGATATCGAGGATGTCCATCTAAATGCCTTCTTTCCTGTTCTTCTACAACTGGCTGATCAAAACGTGGTTCATCTCGCGATTTCTGATTTCTGGGCAACACCTTTTGGTTATACAATTGCATTCCCCATCTGAAAATCTTTCTACTGTTTCTGGTCGTCAGGAACGCAACGATATCCTTTGTCAA

Full Affymetrix probeset data:

Annotations for 1635637_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720