FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635643_at:

>probe:Drosophila_2:1635643_at:39:15; Interrogation_Position=1683; Antisense; ATTAGACCAAAACCATAGCACCCGA
>probe:Drosophila_2:1635643_at:176:673; Interrogation_Position=1698; Antisense; TAGCACCCGATCTGCACGGGTAGAT
>probe:Drosophila_2:1635643_at:417:443; Interrogation_Position=1723; Antisense; GATGAGTTCTCGAAACCATAGACAA
>probe:Drosophila_2:1635643_at:683:23; Interrogation_Position=1747; Antisense; ATATGCACGAGCACTGGCAGTTTCT
>probe:Drosophila_2:1635643_at:605:727; Interrogation_Position=1811; Antisense; TTGTATGTATGTATTATGCCCGCTT
>probe:Drosophila_2:1635643_at:397:705; Interrogation_Position=1824; Antisense; TTATGCCCGCTTTTCTATAACGGAG
>probe:Drosophila_2:1635643_at:678:111; Interrogation_Position=1854; Antisense; AGCAACTTTGCTTTCATATCGAATA
>probe:Drosophila_2:1635643_at:88:475; Interrogation_Position=1894; Antisense; GTTAGCTCCCTAACCAAGCAGAATT
>probe:Drosophila_2:1635643_at:24:169; Interrogation_Position=1920; Antisense; AAAGGCTATTTATCACGCTACCAAG
>probe:Drosophila_2:1635643_at:270:253; Interrogation_Position=1941; Antisense; CAAGCCCAGATCACAGGTCCATGTG
>probe:Drosophila_2:1635643_at:217:535; Interrogation_Position=1956; Antisense; GGTCCATGTGAAATCCCTTTGCCAA
>probe:Drosophila_2:1635643_at:340:417; Interrogation_Position=2050; Antisense; GAGCGCAATTTGACGCGATTCATGT
>probe:Drosophila_2:1635643_at:517:461; Interrogation_Position=2066; Antisense; GATTCATGTAGACCAGTGCTGCTCG
>probe:Drosophila_2:1635643_at:720:85; Interrogation_Position=2080; Antisense; AGTGCTGCTCGCATTCTATGCAAAA

Paste this into a BLAST search page for me
ATTAGACCAAAACCATAGCACCCGATAGCACCCGATCTGCACGGGTAGATGATGAGTTCTCGAAACCATAGACAAATATGCACGAGCACTGGCAGTTTCTTTGTATGTATGTATTATGCCCGCTTTTATGCCCGCTTTTCTATAACGGAGAGCAACTTTGCTTTCATATCGAATAGTTAGCTCCCTAACCAAGCAGAATTAAAGGCTATTTATCACGCTACCAAGCAAGCCCAGATCACAGGTCCATGTGGGTCCATGTGAAATCCCTTTGCCAAGAGCGCAATTTGACGCGATTCATGTGATTCATGTAGACCAGTGCTGCTCGAGTGCTGCTCGCATTCTATGCAAAA

Full Affymetrix probeset data:

Annotations for 1635643_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720