Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635644_at:

>probe:Drosophila_2:1635644_at:464:645; Interrogation_Position=2824; Antisense; TCTTGCTGATGAGTGCCCAGTAGTT
>probe:Drosophila_2:1635644_at:393:505; Interrogation_Position=2836; Antisense; GTGCCCAGTAGTTAGAAACCCGAAT
>probe:Drosophila_2:1635644_at:130:361; Interrogation_Position=2850; Antisense; GAAACCCGAATTCAAGTTGGACAAG
>probe:Drosophila_2:1635644_at:297:29; Interrogation_Position=2886; Antisense; ATACAGTCAGTCTCCTGGCAAATCG
>probe:Drosophila_2:1635644_at:40:237; Interrogation_Position=2906; Antisense; AATCGCTACTGCAACGAATCGCGTA
>probe:Drosophila_2:1635644_at:77:87; Interrogation_Position=2992; Antisense; AGTGCGCAATATTAACCTCAAGTAT
>probe:Drosophila_2:1635644_at:233:217; Interrogation_Position=3011; Antisense; AAGTATTTATTGAGCTCCCAGAGTA
>probe:Drosophila_2:1635644_at:476:57; Interrogation_Position=3067; Antisense; ATGAGTACGTATACCCTAGGAGCTA
>probe:Drosophila_2:1635644_at:704:521; Interrogation_Position=3099; Antisense; GGGCGGGTATACATCCAACTTAACT
>probe:Drosophila_2:1635644_at:401:137; Interrogation_Position=3128; Antisense; ACGATAGCAACCTTTCGAGCGTCGG
>probe:Drosophila_2:1635644_at:442:415; Interrogation_Position=3144; Antisense; GAGCGTCGGTCTATTTTAATCCTAG
>probe:Drosophila_2:1635644_at:668:599; Interrogation_Position=3204; Antisense; TGTCAATAATTTACACCACCCACTC
>probe:Drosophila_2:1635644_at:479:299; Interrogation_Position=3222; Antisense; CCCACTCGACCGAAGGCAAATCTAA
>probe:Drosophila_2:1635644_at:246:569; Interrogation_Position=3300; Antisense; GGCAGACTCAATGCTTTAAGTTTAA

Paste this into a BLAST search page for me
TCTTGCTGATGAGTGCCCAGTAGTTGTGCCCAGTAGTTAGAAACCCGAATGAAACCCGAATTCAAGTTGGACAAGATACAGTCAGTCTCCTGGCAAATCGAATCGCTACTGCAACGAATCGCGTAAGTGCGCAATATTAACCTCAAGTATAAGTATTTATTGAGCTCCCAGAGTAATGAGTACGTATACCCTAGGAGCTAGGGCGGGTATACATCCAACTTAACTACGATAGCAACCTTTCGAGCGTCGGGAGCGTCGGTCTATTTTAATCCTAGTGTCAATAATTTACACCACCCACTCCCCACTCGACCGAAGGCAAATCTAAGGCAGACTCAATGCTTTAAGTTTAA

Full Affymetrix probeset data:

Annotations for 1635644_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime