FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635645_at:

>probe:Drosophila_2:1635645_at:651:19; Interrogation_Position=1005; Antisense; ATTTGAGGATGTCGACGCCTGTGTC
>probe:Drosophila_2:1635645_at:582:705; Interrogation_Position=1044; Antisense; TTACCGCGAGGTTCACAGACACGAT
>probe:Drosophila_2:1635645_at:708:405; Interrogation_Position=1098; Antisense; GACTGAGGATACAGCGACGCCACGT
>probe:Drosophila_2:1635645_at:681:383; Interrogation_Position=1198; Antisense; GAACTAGATCTTAAGCCCGACGAGT
>probe:Drosophila_2:1635645_at:51:215; Interrogation_Position=1226; Antisense; AAGATTTGCTCGACTCGGGAGTACT
>probe:Drosophila_2:1635645_at:81:431; Interrogation_Position=1244; Antisense; GAGTACTTTCCCTTCCAGAGAGGGC
>probe:Drosophila_2:1635645_at:509:211; Interrogation_Position=1277; Antisense; AAGACGCCAAGATGTGCTGTGCCCC
>probe:Drosophila_2:1635645_at:264:397; Interrogation_Position=781; Antisense; GACAACCTCGTCGATGGTGGATCAT
>probe:Drosophila_2:1635645_at:589:589; Interrogation_Position=798; Antisense; TGGATCATTCTTTTACGACACGTAC
>probe:Drosophila_2:1635645_at:316:173; Interrogation_Position=829; Antisense; AAAGACGGTCGCTACATGTCCGTGG
>probe:Drosophila_2:1635645_at:306:563; Interrogation_Position=861; Antisense; GGAACCGCAGTTCTTTGAGATGCTA
>probe:Drosophila_2:1635645_at:685:181; Interrogation_Position=885; Antisense; AAAACAGCGCTTGGAACTGCCCGAA
>probe:Drosophila_2:1635645_at:354:61; Interrogation_Position=911; Antisense; ATGTCAGTCAGTTTGGCGAGGAGCA
>probe:Drosophila_2:1635645_at:76:209; Interrogation_Position=952; Antisense; AAGCTTTTGACTGAGGCTTTCCTCT

Paste this into a BLAST search page for me
ATTTGAGGATGTCGACGCCTGTGTCTTACCGCGAGGTTCACAGACACGATGACTGAGGATACAGCGACGCCACGTGAACTAGATCTTAAGCCCGACGAGTAAGATTTGCTCGACTCGGGAGTACTGAGTACTTTCCCTTCCAGAGAGGGCAAGACGCCAAGATGTGCTGTGCCCCGACAACCTCGTCGATGGTGGATCATTGGATCATTCTTTTACGACACGTACAAAGACGGTCGCTACATGTCCGTGGGGAACCGCAGTTCTTTGAGATGCTAAAAACAGCGCTTGGAACTGCCCGAAATGTCAGTCAGTTTGGCGAGGAGCAAAGCTTTTGACTGAGGCTTTCCTCT

Full Affymetrix probeset data:

Annotations for 1635645_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720