FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635647_at:

>probe:Drosophila_2:1635647_at:85:657; Interrogation_Position=1050; Antisense; TAATGCAGCTTTCAATTCCCAGACA
>probe:Drosophila_2:1635647_at:393:601; Interrogation_Position=1226; Antisense; TGTTTTGGGCTTACATCGTTTAAGT
>probe:Drosophila_2:1635647_at:616:555; Interrogation_Position=678; Antisense; GGACCCATCATAAATTGCAACACTT
>probe:Drosophila_2:1635647_at:374:483; Interrogation_Position=718; Antisense; GTATGTGTCAGAGAACGCAGGATCC
>probe:Drosophila_2:1635647_at:212:107; Interrogation_Position=729; Antisense; AGAACGCAGGATCCGCGAGTCCAGA
>probe:Drosophila_2:1635647_at:462:85; Interrogation_Position=746; Antisense; AGTCCAGAACGCTGTGTCGTGTGCA
>probe:Drosophila_2:1635647_at:321:285; Interrogation_Position=757; Antisense; CTGTGTCGTGTGCATGGCTCAAAGC
>probe:Drosophila_2:1635647_at:315:383; Interrogation_Position=784; Antisense; GAACGTAGTAGTCATGCCATGCCGG
>probe:Drosophila_2:1635647_at:323:567; Interrogation_Position=807; Antisense; GGCACCTCTGCCTCTGCAAAGAGTG
>probe:Drosophila_2:1635647_at:232:171; Interrogation_Position=824; Antisense; AAAGAGTGCTCCCTGCAGCTCGTGC
>probe:Drosophila_2:1635647_at:533:117; Interrogation_Position=840; Antisense; AGCTCGTGCTCCTTTTAGAAGACCG
>probe:Drosophila_2:1635647_at:513:109; Interrogation_Position=856; Antisense; AGAAGACCGCTGTCCTGTCTGCAGG
>probe:Drosophila_2:1635647_at:502:499; Interrogation_Position=872; Antisense; GTCTGCAGGCACAACATTACGTCGT
>probe:Drosophila_2:1635647_at:82:13; Interrogation_Position=887; Antisense; ATTACGTCGTTCCTGTCAGTTTACG

Paste this into a BLAST search page for me
TAATGCAGCTTTCAATTCCCAGACATGTTTTGGGCTTACATCGTTTAAGTGGACCCATCATAAATTGCAACACTTGTATGTGTCAGAGAACGCAGGATCCAGAACGCAGGATCCGCGAGTCCAGAAGTCCAGAACGCTGTGTCGTGTGCACTGTGTCGTGTGCATGGCTCAAAGCGAACGTAGTAGTCATGCCATGCCGGGGCACCTCTGCCTCTGCAAAGAGTGAAAGAGTGCTCCCTGCAGCTCGTGCAGCTCGTGCTCCTTTTAGAAGACCGAGAAGACCGCTGTCCTGTCTGCAGGGTCTGCAGGCACAACATTACGTCGTATTACGTCGTTCCTGTCAGTTTACG

Full Affymetrix probeset data:

Annotations for 1635647_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720