Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635649_at:

>probe:Drosophila_2:1635649_at:133:355; Interrogation_Position=255; Antisense; GCACCACCTGTGGAAGGGCTATGTA
>probe:Drosophila_2:1635649_at:657:681; Interrogation_Position=274; Antisense; TATGTACGCGAGCATCTGGAGCTGA
>probe:Drosophila_2:1635649_at:219:81; Interrogation_Position=320; Antisense; AGGTGCACGATGCTCGCTACGACGA
>probe:Drosophila_2:1635649_at:74:671; Interrogation_Position=337; Antisense; TACGACGAGTTCAGCCGCAAGTTGG
>probe:Drosophila_2:1635649_at:39:613; Interrogation_Position=362; Antisense; TGAAACTGGACTTGCACGGTGCCAA
>probe:Drosophila_2:1635649_at:308:125; Interrogation_Position=415; Antisense; ACCCTGGAAAATTTGGCTGGCATCT
>probe:Drosophila_2:1635649_at:458:583; Interrogation_Position=432; Antisense; TGGCATCTGCGTCATGGACACCAAG
>probe:Drosophila_2:1635649_at:45:109; Interrogation_Position=455; Antisense; AGAACGTGCTGAAACTGCTCGGCAA
>probe:Drosophila_2:1635649_at:447:225; Interrogation_Position=478; Antisense; AAGGACCATCGGCTGCGCACAATAC
>probe:Drosophila_2:1635649_at:445:27; Interrogation_Position=499; Antisense; ATACCCAAGAGCGAGTGCGTCTTTG
>probe:Drosophila_2:1635649_at:201:551; Interrogation_Position=543; Antisense; GGAGTTCACCATATTCGGGCAGCAC
>probe:Drosophila_2:1635649_at:156:413; Interrogation_Position=578; Antisense; GACCCGCCGAGCGAAGCGTTAAGAA
>probe:Drosophila_2:1635649_at:228:509; Interrogation_Position=616; Antisense; GTGAAGCCCTTCATGTAGGAACTAC
>probe:Drosophila_2:1635649_at:387:31; Interrogation_Position=734; Antisense; ATAATTGCCCTCAAAGATCCTCTAA

Paste this into a BLAST search page for me
GCACCACCTGTGGAAGGGCTATGTATATGTACGCGAGCATCTGGAGCTGAAGGTGCACGATGCTCGCTACGACGATACGACGAGTTCAGCCGCAAGTTGGTGAAACTGGACTTGCACGGTGCCAAACCCTGGAAAATTTGGCTGGCATCTTGGCATCTGCGTCATGGACACCAAGAGAACGTGCTGAAACTGCTCGGCAAAAGGACCATCGGCTGCGCACAATACATACCCAAGAGCGAGTGCGTCTTTGGGAGTTCACCATATTCGGGCAGCACGACCCGCCGAGCGAAGCGTTAAGAAGTGAAGCCCTTCATGTAGGAACTACATAATTGCCCTCAAAGATCCTCTAA

Full Affymetrix probeset data:

Annotations for 1635649_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime